The Lac Operon 1961 , Jacob and Monod E. coli and other bacteria

1. The Lac Operon1961, Jacob and MonodE. coli and other bacteria • Bacterial Genes • Many genes constitutively expressed • “housekeeping” genes • Other genes are more regulated • Can be turned on, or off depending on cell needs

2. HOUSEKEEPING GENES • actin, beta (ACTB) • glyceraldehyde-3-phosphate dehydrogenase • ribosomal protein S27a • H2B histone family, member L • ATP synthase • eukaryotic translation initiation factor 3, subunit 8 • nascent-polypeptide-associated complex alpha polypeptide • adenosine deaminase • E2F transcription factor 4

3. REGULATED GENES • Insulin receptor • Methylation enzymes • Digestive enzymes • Neurotransmitters • Transcription factors • Hormone genes

4. Operon • group of coordinately regulated genes • 1 promoter for a number of genes • Polycistronic mRNA • Inducer molecule – turns operon on

5. E. Coli Lac Operon • E. coli cells normally grown in glucose • BUT, if lactose is used instead: •  convert lactose to glucose and galactose

6. The Lac Operon allows for coordinate gene expression Note: 1 mRNA, promoter, 3 genes

7. THE OPERON HAS • A. 3 STUCTURAL GENES = Z, Y, A

8. Lac Z gene encodes betagalactosidase b-gal lactose ------------- glucose + galactose substrate products No lactose present  ~ 3 molecules of bgal Add lactose  3,000 molecules of bgal

9. So………………….. • b- gal is aninducible enzyme • What is the role of lactose? • inducer

10. Lac Operon • B. promoter = allows transcription of ZYA • C. operator = must be unbound for P to be “open” • What molecule are ALL of the components above?

11. Lac Ygene encodes permeasethattransports lactose into cell • Lac Aencodes a transacetylase

12. D. Lac I gene • Encodes a repressor protein • Repressor binds to operator

13. Is this operon ON or OFF? Is lactose PRESENT or ABSENT?

14. Which components act in cis? In trans?

15. Regulation of the Lac Operon • Its normally repressed! = OFF • Because lactose is absent • Therefore, it is an inducible operon • When lactose is present

16. INDUCER (LACTOSE SUGAR) 1. Lactose enters cell

17. 2. Binds repressor protein causing conformational change

18. 3. repressor cannot bind operator

19. 4. RNA polymerase transcribes genes 5. Cell metabolizes lactose

20. Lactose (the inducer) enters the cell Binds repressor protein causing a conformational change

21. No lactose: repressor binds operator polymerase cannot bind promoter no transcription of ZYA genes

22. Why study the lac operon? • “The lac operon is one of the most basic examples of gene regulation.  Gene regulation is an important area of study in medicine as many diseases and conditions are as a result of deficiencies in gene regulation.  Cancer is one such disease that results in the inability of a cell to control the genes that regulate its growth.  Many systems of gene regulation in humans are quite complex and not understood by biologists and researchers.  In studying simple models of gene regulation, we hope to perhaps gain some insight into how more complex gene regulatory systems work.”

23. Lac operon animation

24. Promoter region of the operon -35 -10 +1 GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA LACZ CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT

25. Operon mutants Mutant Mutant Phenotype lacI -constitutiveexpression because…

26. This operon is not inducible

27. Mutant Mutant Phenotype Occonstitutiveexpression because …

28. Mutant Mutant Phenotype P-operon always off because……

29. Mutant phenotype Z- operon is?

30. Operon on, or off in the absence of lactose? Lac OcI+P+OcZ+Y+A+ In presence of lactose? Is it Inducible?

31. Operon on, or off in the absence of lactose? Lac I- I-P+O+Z+Y+A+ In presence of lactose? Is it Inducible?

32. Partial diploid cells contain a plasmid F’ I+ Inducible? I-P+O+Z+Y+A+

33. F’ I- P- Z+Y-A- I+P+O+Z- Y+A+ Inducible?

34. Tips for plasmid analysis • Repressor and polymerase = proteins • diffusible • Proteins can bind DNA • act in TRANS • promoter, operator, and ZYA and I = genes • cannot move • act in CIS

35. Lac operon notes • The lac operon is under negative control • Allolactose binds to allosteric site on repressor causing shape change • If both glucose and lactose are present, lac genes weakly transcribed • Maximal transcription when lactose is only source • cyclic AMP and a catabolite activator protein produce this effect. • The concentration of cyclic AMP in E. coli is inversely proportional to the concentration of glucose: as the concentration of glucose decreases, the concentration of cyclic A • When the concentration of glucose is low, cAMP accumulates in the cell. The binding of cAMP and the catabolite activator protein to the lac promoter increases transcription by enhancing the binding of RNA polymerase to the lac promoter. MP increases. • Lac I gene has its own promoter • Repressor is a 360 aa protein tetramer. • Lac I promoter is weak, few repressor molecules in cell • Super repressor binds to operator even in presence of lactose

36. Positive control of lac operon • CAP binds to cAMP • CAP-cAMP binds to CAP site upstream of promoter • CAP recruits RNA pol • With glucose: + lactose • Glucose preferentially used • Catabolite repression because glucose reduces levels of cAMP • Lac operon at low levels