1 / 27

Section 11.1 Summary – pages 281 - 287

DNA REPLICATION REVIEW. Section 11.1 Summary – pages 281 - 287. 1. When does DNA divide? 2. Why does it happen at this time?. What is the first step in DNA replication?. Next, what is the job of the enzyme Helicase ?. What is the replication fork?. 1. What happens next?.

chaim-hunter
Download Presentation

Section 11.1 Summary – pages 281 - 287

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA REPLICATION REVIEW Section 11.1 Summary – pages 281 - 287 1. When does DNA divide? 2. Why does it happen at this time?

  2. What is the first step in DNA replication? • Next, what is the job of the enzyme Helicase?

  3. What is the replication fork?

  4. 1. What happens next? • What enzyme is responsible for this action? • What is the significance of the three phosphates on the free nucleotides?

  5. LEADING STRAND VS. LAGGING STRAND

  6. Why does the DNA always have to build from the original DNA’s 3’?

  7. Why does the DNA always have to build from the original DNA’s 3’?

  8. The Flow of Genetic Information. How you get from a gene to a protein. transcription translation RNA DNA protein DNA gets all the glory, but proteins do all the work! replication We’ve talked about replication, now we will focus on TRANSCRIPTION…

  9. Transcription The process of copyinga segment of DNAinto RNA. This is the first step in protein synthesis.

  10. DNA holds the instructions to make proteins, but can NOT leave the nucleus. Proteins are made outside of the nucleus on the tiny organelles called ribosomes. What’s the problem? The DNA needs a messenger to take a copy of the instructions to the ribosomes so the proteins can be made.

  11. Other than DNA, what is another type of nucleic acid? • There are 3 types of RNA, but today we will only mostly focus on one- mRNA. Section 11.2 Summary – pages 288 - 295 SIDE-NOTE! Messenger RNA (mRNA) delivers a copy of DNA’s instructions from the nucleus to the ribosomes.

  12. RNA’s structure differs from DNA’s structure in three ways. Section 11.2 Summary – pages 288 - 295 # 1 RNA is single stranded—it looks like one-half of a zipper—whereas DNA is double stranded.

  13. Section 11.2 Summary – pages 288 - 295 # 2 • The sugar in RNA is ribose; • REMEMBER:DNA’s sugar is deoxyribose.

  14. # 3 Section 11.2 Summary – pages 288 - 295 • Finally, both DNA and RNA can contain four nitrogenous bases, BUT RNA does not have Thymine. • Thymine is replaced by a similar base called uracil (U). What do you notice instead? Uracil forms a base pair with adenine in RNA.

  15. Steps of Transcription • DNA is uncoiled by enzymes and unzips using Helicase, just as it does in DNA replication.

  16. Steps of Transcription • An enzyme called RNA polymerase recognizes and binds to a DNA at a site called a “promoter”. • A promoter is a base sequence in DNA that signals the start of a gene.

  17. Steps of Transcription 3. The RNA Polymerase then moves along the DNA strand’s 3’ 5’prime direction, joining one free RNA nucleotide after another until it reaches a termination sequence.

  18. Steps of Transcription 4. Once the termination sequence is reached, the entire ‘coding gene’ has been transcribed into an mRNA strand, and the mRNA is cut away from the DNA.

  19. Transcription differs from DNA replication in three key respects… • Instead of copy the whole DNA strand, only a selected gene within the DNA is copied. • Instead of DNA polymerase attaching free nucleotides, it is RNA polymerase. • At the end of transcription there is a single, free strand of RNA nucleotides, not a double helix.

  20. Transcription is complete at this point. The mRNA at this point is considered “pre-mRNA”. HOWEVER, the mRNA is not yet ready to leave the nucleus and deliver DNA’s message. It first needs some “finishing touches”…… called Post-Transcriptional mRNA processing.

  21. 3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G Post-transcriptional processing • First a cap and tail are added to the mRNA strand. • Why? • The cap helps the mRNA bind to the ribosome 5 GTP cap (modified Guanine nucleotide) • The tail keeps enzymes in the cytoplasm from “attacking” the mRNA strand. poly-A tail (string of Adenine nucleotides)

  22. intron = non-coding (in-between) sequence exon = protein coding (expressed) sequence Remember - Eukaryotic genes have “junk”! • Eukaryotic genes are not continuous • exons = the real gene • expressed / coding DNA • introns = the junk, stuff you don’t need in order to build a protein. • inbetween sequence eukaryotic DNA

  23. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence mRNA splicing – Taking out the “Trash” • Edit out the introns • A “mature” mRNA strand has now been formed • It is much shorter than the original • Exons are Exported, Introns stay IN the nucleus ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

  24. Splicing must be accurate • No room for mistakes! • a single base added or lost affects the entire protein AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

  25. snRNPs snRNA intron exon exon 5' 3' spliceosome 5' 3' lariat 5' 3' exon exon mature mRNA excised intron 5' 3' RNA splicing enzymes • Spliceosome • Made of small nuclear ribosomes • recognize splice site sequence • cut & paste gene

  26. aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein

More Related