1 / 44

Utility and use of zebrafish as model for understanding angiogenesis.

Cell signaling, endothelial migration, and zebrafish: a simplified model for angiogenesis Khalid Boushaba, Jeffrey Essner, and Howard Levine Iowa State University. Utility and use of zebrafish as model for understanding angiogenesis. VEGF signaling in zebrafish during angiogenesis.

chanel
Download Presentation

Utility and use of zebrafish as model for understanding angiogenesis.

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Cell signaling, endothelial migration, and zebrafish: a simplified model for angiogenesis Khalid Boushaba, Jeffrey Essner, and Howard Levine Iowa State University Utility and use of zebrafish as model for understanding angiogenesis. VEGF signaling in zebrafish during angiogenesis. Mathematical modeling of angiogenesis

  2. Cell signaling, endothelial migration, and zebrafish: a simplified model for angiogenesis

  3. Zebrafish as a High-throughput Model for Angiogenesis Research and Therapeutic Development Large number of offspring Optically clear embryos Short generation time Small Size Reverse Genetics: Transgenic fish Tilling with ENU Morpholino injection Forward Genetics: ENU mutagenesis Insertional mutagenesis Genomics: Sequenced Genome cDNA projects Microarrays Small Molecule Screens: Predictive of higher vertebrates Delivery by injection or soaking Carcinogenesis: Aqueous delivery Similar to human tumors

  4. Zebrafish embryos are optically clear and develop rapidly From Karlstrom and Kane, 1996

  5. Model of Tumor Angiogenesis From Yancopoulos et al., 2000 Novel Angiogenic Factors Candidate Anti-Tumor Agents

  6. Advantages of Studying Angiogenesis in Zebrafish Angiogenesis is a conserved vertebrate-specific function Analysis in living embryos 2.7 dpf

  7. Transgenic zebrafish allow analysis of endothelial cells in living embryos fli1-egfp transgenic embryo at 2 dpf Dorsal Longitudinal Anastomotic Vessel (DLAV) Intersegmental Vessels (Se) Posterior Cardinal Vein (PCV) Caudal Vein Capillary Plexus Dorsal Aorta (DA)

  8. Advantages of Studying Angiogenesis in Zebrafish Microangiography: analysis of blood flow in living embryos

  9. The intersegmental vessels form by sprouting angiogenesis

  10. ve-cadherin expression identifies primitive endothelial cells in the early zebrafish embryo

  11. Primary angiogenesis in the trunk and tail are apparent at 24 hpf ve-cadherin in situ hybridization

  12. Each intersomitic vessel is composed of three endothelial cells fli1-egfp transgenic embryo at 2 dpf

  13. fli1/gfp embryos allow the behavior of individual cells to be followed during primary angiogenesis Movies from Brant Weinstein’s lab at the NIH

  14. Discovery Genomics, Inc. Karl J. Clark Jon Larson Aidas Nasevicius Shannon Wadman Perry B. Hackett Iowa State University Hsin-Kai Liao Ying Wang Danhua Zhang Katie Lutz University of Minnesota Eleanor Chen Stephen C. Ekker Max-Planck Institute - Freiburg Matthias Hammerschmidt Angiogenetics, AB Mats Hellstrom

  15. BASEn O O CH3 N N CH3 P BASEn+1 O O O CH3 N CH3 N P O Mechanism of Morpholino Phosphoramidate Inhibition Antisense oligonucleotides Designed as 25 mers Bind tightly Resistant to digestion Low toxicity Not RNAseH mediated Inhibition of Translation Encoded Protein 60S 60S 60S 40S 40S AUGACCGGUAUUAGUCCGGACCUAG•••••••AAAAA 40S 40S MPO AUGACCGGUAUUAGUCCGGACCUAG•••••••AAAAA 40S

  16. Microinjection : An Efficient Morpholio Delivery System Injection Site 1.5 hrs 4 hrs 0 hr Easy to perform: can inject thousands of embryos per day 28 hrs Nasevicius and Ekker (2000, 2001)

  17. Microarray Pre-selection vs. Random Selection Random ENU Mutagenesis screens: Genes are mutated randomly with a chemical mutagen in a forward genetic screen (Habeck et al., 2002). Subsequent gene identification is difficult. 0.5% of genes (approximately 1/200) are estimated to affect angiogenesis. SelectedCandidates Random Screens 0.5% SelectedCandidates DGI/AG Screen Discovery Genomics, Inc. /AngioGenetics AB Pilot Screen: Targets were pre-selected basedon microarray data. 16% of genes (8/50) were identified as angiogenesis candidates. 16%

  18. Syndecan-2 VEGF/VEGFR1&2 ? ? erm1 ? F-actin erm1 may associate with Syndecan-2 during vascular formation to transmit VEGF-signaling

  19. Hypothesis I: endothelial migration is dependent on the concentration of VEGF Migration VEGF VEGFR2 (flk1)

  20. The embryonic midline influences vasculogenesis and angiogenesis by inducing VEGF expression Lawson et al., 2001

  21. VEGF is required for the correct number of endothelial cells ve-cadherin expression

  22. Vasculogenesis is dependent on VEGF in zebrafish embryos Wt VEGF MO 3 dpf

  23. VEGF-A is required for vasculogenesis in zebrafish Nasevicius et al., 2000 Microangiography allows high resolution mapping of mature vessels.

  24. Migration of the intersegmental vessels is severely affected in VEGF-A knockdown embryos at 2 dpf Wt VEGF-A

  25. Endothelial migration is dependent on the concentration of VEGF Wt VEGF MO Migration VEGF VEGF VEGFR2 (flk1) VEGFR2 (flk1)

  26. Formation of the intersegmental vessels by sprouting angiogenesis requires VEGF Zebrafish ve-cadherin expression at 48 hpf

  27. Gradients can be set up and interpreted in many different ways Planar transcytosis Argosomes Cytonemes Restricted diffusion

  28. Endothelial migration is dependent on the concentration of VEGF Wt VEGF MO VEGF MO + hVEGF Migration Migration VEGF VEGF VEGF VEGFR2 (flk1) VEGFR2 (flk1) VEGFR2 (flk1)

  29. VEGF signaling is conserved during zebrafish vascular development VEGF and VEGFR2/flk1 In zebrafish there are two flk1 genes: flk1a and flk1b. Simultaneous knockdown of both flk1a and flk1b resembles VEGF-A knockdown embryos.

  30. Endothelial migration is dependent on the concentration of VEGF and VEGFR2 wt flk1a and flk1b MO Migration VEGF VEGF VEGFR2 (flk1) VEGFR2 (flk1)

  31. ? Syndecan-2, a heparan sulfate-containing proteoglycan, is essential for angiogenic sprouting of blood vessels WT fli-1 Syn2 MO, fli-1 Chen et al., 2004 Syndecan-2 VEGF/VEGFR1&2

  32. Vascular Endothelial Growth Factor A (VEGF-A) VEGF 121 VEGF 145 VEGF 165 VEGF 183 VEGF 189 VEGF 206 Heparan Sulfate Binding Region Robinson & Stringer, 2001

  33. Endothelial migration is dependent on the concentration of VEGF, VEGFR2, and Syndecan-2 Migration VEGF VEGF Syndecan2 presenting cells VEGFR2 (flk1) VEGFR2 (flk1)

  34. Syndecan-2 may function in multiple ways Syndecan-2 Phosphoserine Growth Factor and Receptor A Cell-autonomous B Cell-autonomous Presentation model Complex model C Cell-nonautonomous, inside-outside signaling model

  35. Endothelial migration is dependent on the concentration of VEGF wt VEGF +Syn2 MO VEGF MO + hVEGF Migration Migration VEGF VEGF VEGF Syndecan2 presenting cells VEGFR2 (flk1) VEGFR2 (flk1) VEGFR2 (flk1) VEGFR2 (flk1)

  36. Ectodomain C1 V C2 YRMRKKDEGSY DLGERKPSSAAYQKAPTK EFYA EphB2 PKCg Ezrin Synbindin Synectin Syntenin CASK • A • Ezrin • Synectin • F-actin • B C-terminal cytoplasmic domains HS Chains Phosphorylation sites Serines and Tyrosines

  37. Endothelial migration is dependent on the concentration of VEGF and VEGF requires Syndecan2 for signaling Migration VEGF Syndecan2 presenting cells VEGFR2 (flk1)

  38. Mass action law

  39. Biochemical equations

  40. Role of cell cycle and cell movement equations

  41. Cell movement

  42. Full model equations

More Related