1 / 34

G enotyping & Haplotyping

G enotyping & Haplotyping. Genotyping. Analysis of DNA-sequence variation Human DNA sequence is 99.9% identical between individuals →3000 000 varying nucleotides Polymorphism: normal variation between individuals (frequency > 1% of population) Genetic variation

chaz
Download Presentation

G enotyping & Haplotyping

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Genotyping & Haplotyping

  2. Genotyping • Analysis of DNA-sequence variation • Human DNA sequence is 99.9% identical between individuals →3000 000 varying nucleotides • Polymorphism: normal variation between individuals (frequency> 1% of population) • Genetic variation • May cause or predispose to inheritable diseases • Determines e.g. individual drug response • Used as markers to identify disease genes Finnish Genome Center

  3. Important terms • Allele • Alternative form of a gene or DNA sequence at a specific chromosomal location (locus) • at each locus an individual possesses two alleles, one inherited from each parent • Genotype • genetic constitution of an individual, combination of alleles • Genetic marker • Polymorphisms that are highly variable between individuals: Microsatellites and single nucleotide polymorphisms (SNPs) • Marker may be inherited together with the disease predisposing gene because of linkage disequilibrium (LD) Finnish Genome Center

  4. Linkage disequilibrium, LD • Alleles are in LD, if they are inherited together more often than could be expected based on allele frequencies • Two loci are inherited together, because recombination during meiosis separates them only seldom Finnish Genome Center

  5. Microsatellite markers Di-, tri-, tetranucleotide repeats GAACGTACTCACACACACACACATTTGAC TTCGATGATAGATAGATAGATAGATACGT • the number of repeats varies (→ 30) • highly polymorphic • distributed evenly throughout the genome • easy to detect by PCR Finnish Genome Center

  6. SNP markers • Single Nucleotide Polymorphisms (SNPs) GTGGACGTGCTT[G/C]TCGATTTACCTAG • The most simple and common type of polymorphism • Highly abundant; every 1000 bp along human genome • Most SNPs do not affect on cell function • some SNPs could predispose people to disease or • influence the individual’s response to a drug Finnish Genome Center

  7. SNP genotyping techniques • over 100 different approaches • Ideal SNP genotyping platform: • high-throughput capacity • simple assay design • robust • affordable price • automated genotype calling • accurate and reliable results Finnish Genome Center

  8. ...SNP genotyping techniques • PCR • discrimination between alleles: • allele-specific hybridization • allele-specific primer extension • allele-specific oligonucleotide ligation • allele-specific enzymatic cleavage • detection of the allelic discrimination: • light emitted by the products • mass • change in the electrical property Finnish Genome Center

  9. High-throughput genotyping; Finnish Genome Center as an example • Independent department of University of Helsinki since 1998 • National core facility for the genetic research of multifactorial diseases • Provides collaboration and genotyping service to scientist and research groups in Finland, also abroad Finnish Genome Center

  10. Goals of the Finnish Genome Center • help designing genetic studies • perform high-throughput genotyping • perform data analysis • training of scientists • adopt and develop new strategies & technologies Finnish Genome Center

  11. Research strategies • Genome-wide scan • ~400 microsatellite markers at 10 cM interval • Family-data • Fine mapping • Candidate regions identified by a genome scan • Project specific microsatellite or SNP markers • SNP genotyping • Candidate genes • Fine mapping • Sequenom: MassArray MALDI-TOF Finnish Genome Center

  12. Setting up PCR-reactions Finnish Genome Center

  13. Electrophoresis run for microsatellites Finnish Genome Center

  14. Microsatellite data Marker Well ID SampleID Allele1 Allele2 Size1 Size2 D7S513 H01 OA.11616 26 28 190.93 195.02 D7S517 C07 DYS.5020 26 26 262.19 262.19 D7S640 B02 DYS.3819 26 29 133.41 139.41 D7S640 G12 OA.1528 26 29 133.59 139.46 D7S669 E05 OA.11615 26 29 190.37 196.61 D8S258 B06 DYS.5001 26 27 159.38 161.38 D8S260 C02 DYS.3931 26 26 215.57 215.57 D8S264 H01 OA.11616 26 26 158.86 158.86 Finnish Genome Center

  15. SNP genotyping with MassARRAY (MALDI-TOF) • Primer extension reactions designed to generate different sized products • Analysis by mass spectrometry C/T G/A dTTP dGTP ddCTP dATP G/A Mass in Daltons Extendable primer GGACCTGGAGCCCCCACC 5430.5 C analyte GGACCTGGAGCCCCCACCC 5703.7 Tanalyte GGACCTGGAGCCCCCACCTC 5976,9.9 Finnish Genome Center

  16. Mass spectrometry multiplexing Finnish Genome Center

  17. SNP data Finnish Genome Center

  18. SNP genotyping workflow at FGC Finnish Genome Center

  19. Haplotype alleles • Multiple loci in the same chromosome that are inherited together • Usually a string of SNPs that are linked locus haplotypes Finnish Genome Center

  20. Haplotype construction • No good molecular methods available to identify haplotypes Genotypes → Haplotypes, two alternatives SNP1 AT A T A T SNP2 GC G C C G → Computational methods to create haplotypes from genotype data Finnish Genome Center

  21. ...Haplotype construction • Family-based haplotype construction • Linkage analysis softwares: Simwalk, Merlin, Genehunter, Allegro... • Population-based haplotype construction • Not as reliable as family-based • EM-algorithm (expectation maximization algorithm), described in http://www-gene.cimr.cam.ac.uk/clayton/software/ • SnpHap • PHASE Finnish Genome Center

  22. Haplotype blocks • Low recombination rate in the region • Strong LD • Low haplotype diversity • Small number of SNPs in the block are enough to identify common haplotypes; tag SNPs Finnish Genome Center

  23. Formation of haplotype blocks x meiosis 1 1 1 2 2 2 2 2 1 1 1 2 recombination chromosomes Finnish Genome Center

  24. Few generations Hundreds of generations 2 2 1 2 3 1 Finnish Genome Center

  25. 1-150 kb Average block size • African populations: 11 kb • Non-african populations: 22 kb • 60%-80% of the genome is in the blocks of > 10 kb Finnish Genome Center

  26. Block frequencies Typically, only 3-5 common haplotypes account for >90% of the observed haplotypes Finnish Genome Center

  27. Benefits of haplotypes instead of individual SNPs • Information content is higher • Gene function may depend on more than one SNP • Smaller number of required markers • The amount of wrong positive association is reduced • Replacing of missing genotypes by computational methods • Elimination of genotyping errors • Challenges: • Haplotypes are difficult to define directly in the lab; computational methods • Defining of block boarders is ambiguous; several different algorithms Finnish Genome Center

  28. The HapMap project • International collaboration to create a map of human genetic variation • The map is based on common haplotype patterns • Includes information on • SNPs (location, frequency, sequence) • Haplotype block structure • Distribution of haplotypes in different populations Finnish Genome Center

  29. Finnish Genome Center

  30. Finnish Genome Center

  31. Finnish Genome Center

  32. Finnish Genome Center

  33. Finnish Genome Center

  34. Finnish Genome Center

More Related