1 / 2

TABLE S1. Primers used in mutagenesis of Q motif of FANCJ and BLM

TABLE S1. Primers used in mutagenesis of Q motif of FANCJ and BLM. TABLE S2. DNA substrates or oligonucleotides used in this study. 5’. 26. DC26: TTTTTTTTTTTTTTTTTTTTTTCCCAGTAAAACGACGGCCAGTGC T STEM 25: GCGGTCCCAAAAGGGTCAGTGCTGGCATTTTGCTGCCGGTCACG. I I I I I I I I I I I I I I I I I I I.

Download Presentation

TABLE S1. Primers used in mutagenesis of Q motif of FANCJ and BLM

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. TABLE S1. Primers used in mutagenesis of Q motif of FANCJ and BLM

  2. TABLE S2. DNA substrates or oligonucleotides used in this study 5’ 26 DC26: TTTTTTTTTTTTTTTTTTTTTTCCCAGTAAAACGACGGCCAGTGC TSTEM25: GCGGTCCCAAAAGGGTCAGTGCTGGCATTTTGCTGCCGGTCACG I I I I I I I I I I I I I I I I I I I 19 bp 25 3’ 5’ 3’ BiodT represents an internal biotin conjugated dT.

More Related