1 / 1

Supplementary Table 2: Nucleotide sequence of primers used for PCR amplification

Supplementary Table 2: Nucleotide sequence of primers used for PCR amplification. Gene Accession no. Sequence cDNA Annealing Product Source

doria
Download Presentation

Supplementary Table 2: Nucleotide sequence of primers used for PCR amplification

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Supplementary Table 2: Nucleotide sequence of primers used for PCR amplification Gene Accession no. Sequence cDNA Annealing Product Source position Temp. size BRN3B F NM_004575 CAGGTTCGAGTCCCTCACAC 903 60 BRN3B R ATGGCAAAGTAGGCTTCGAGC 1100 60 198 primer bank (id:4758948a2) HUD F NM_021952.2 GAAACTGTCCTTCTCCCATGC 310 64 HUD R GATTGAGGCAGAGCTCGGAC 611 64 301 self designed ISL1 F NM_002202 CAGGTTGTACGGGATCAAATGC 207 60 ISL1 R CACACAGCGGAAACACTCGAT 315 60 109 primer bank (id:4504737a2) Cloning primers BRN3B 4586 BGL II F TACCAGATCT-CAACACCGCGGGAAGTATAG 60 BRN3B 6248 SAL I R AATTGTCGAC-CGCTGGTCCGTAGAGGCACTCA 60 1.6KB pEGFP1 sequencing primer CTCTGACTTGAGCGTCGATT 3981 60 Supplementary Table 3: Sources and dilutions of antibodies used for immunohistochemical studies Antibody Raised in Supplier Catalogue no. Dilution B-actin mouse Sigma A5316 (clone-AC-74) 1/5000 (wb) BRN3B goat Santa Cruz N-15 sc-31987 1/200 (wb) CD44 (anti human) mouse Serotec MCA89T 1/1000 ED1 mouse Serotec MCA 341R 1/1000 GFP rabbit MBL 598 1/500 HUD rabbit Santa Cruz sc-2536 1/500 ISL1 mouse DSHB 39.4D5 1/50, 1/100 (wb) Ki67 mouse Novocastra 1/1000 Neurofilament 200 mouse DSHB RT97 1in 2 Notch 1 rabbit Santa Cruz C-20 sc-6014 1/100 (wb) Notch1 activated or Cleaved Notch 1 (Val1744) rabbit Cell Signaling #2421 1 in 50 Notch 1(bTan20) rat DSHB bTan20 1 in 20 (wb)= western blotting

More Related