10 likes | 272 Views
Supplementary Table 2: Nucleotide sequence of primers used for PCR amplification. Gene Accession no. Sequence cDNA Annealing Product Source
E N D
Supplementary Table 2: Nucleotide sequence of primers used for PCR amplification Gene Accession no. Sequence cDNA Annealing Product Source position Temp. size BRN3B F NM_004575 CAGGTTCGAGTCCCTCACAC 903 60 BRN3B R ATGGCAAAGTAGGCTTCGAGC 1100 60 198 primer bank (id:4758948a2) HUD F NM_021952.2 GAAACTGTCCTTCTCCCATGC 310 64 HUD R GATTGAGGCAGAGCTCGGAC 611 64 301 self designed ISL1 F NM_002202 CAGGTTGTACGGGATCAAATGC 207 60 ISL1 R CACACAGCGGAAACACTCGAT 315 60 109 primer bank (id:4504737a2) Cloning primers BRN3B 4586 BGL II F TACCAGATCT-CAACACCGCGGGAAGTATAG 60 BRN3B 6248 SAL I R AATTGTCGAC-CGCTGGTCCGTAGAGGCACTCA 60 1.6KB pEGFP1 sequencing primer CTCTGACTTGAGCGTCGATT 3981 60 Supplementary Table 3: Sources and dilutions of antibodies used for immunohistochemical studies Antibody Raised in Supplier Catalogue no. Dilution B-actin mouse Sigma A5316 (clone-AC-74) 1/5000 (wb) BRN3B goat Santa Cruz N-15 sc-31987 1/200 (wb) CD44 (anti human) mouse Serotec MCA89T 1/1000 ED1 mouse Serotec MCA 341R 1/1000 GFP rabbit MBL 598 1/500 HUD rabbit Santa Cruz sc-2536 1/500 ISL1 mouse DSHB 39.4D5 1/50, 1/100 (wb) Ki67 mouse Novocastra 1/1000 Neurofilament 200 mouse DSHB RT97 1in 2 Notch 1 rabbit Santa Cruz C-20 sc-6014 1/100 (wb) Notch1 activated or Cleaved Notch 1 (Val1744) rabbit Cell Signaling #2421 1 in 50 Notch 1(bTan20) rat DSHB bTan20 1 in 20 (wb)= western blotting