1 / 17

NAT Standards for Clinical Virology

NAT Standards for Clinical Virology. Sally Baylis, NIBSC SoGAT XX, Warsaw 12-13 June 2007. Standardisation – Clinical Virology.

chiko
Download Presentation

NAT Standards for Clinical Virology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. NAT Standards for Clinical Virology Sally Baylis, NIBSC SoGAT XX, Warsaw 12-13 June 2007

  2. Standardisation – Clinical Virology • NIBSC is working with the UK Clinical Virology Network (CVN) & the Health Protection Agency (HPA) to develop a standardisation programme to provide run controls for diagnostic laboratories

  3. Initial Studies • Panels of viruses have been distributed to participating laboratories to select suitable run control formulations, these have included: • Influenza A (H1N1, H3N2) • Influenza B • Herpes simplex virus (HSV-1 & HSV-2) • Cytomegalovirus • Norovirus GII

  4. Initial Studies contd. Viruses diluted into virus transport medium & distributed to the participating laboratories Participants requested to test materials using routine extraction & amplification/detection procedures Data is returned electronically to NIBSC for analysis Returned data is used to make decisions on suitable formulations for further evaluation

  5. HCVM Stock Material Used in Phase I Studies • Human cytomegalovirus (HCMV), Towne strain was cultured in vitro at the West of Scotland Specialist Virology Centre, Glasgow

  6. Analysis of HCMV Results - Phase I ** Run controls as expected

  7. Results • Laboratory F failed to generate Ct values for HCMV distributed in Phase I of the study • Extensive follow up was performed to identify why this and another laboratory using the same assay had unexpected results • Analysis of reactions on agarose gels revealed that product of the expected size was being amplified

  8. Alignment of Towne Strain with TaqMan Probe • Assay targets glycoprotein gene of HCMV • Analysis of the primer sequences revealed a mismatch in the middle of the reverse primer • Analysis of sequence of probe vs Towne strain of HCMV revealed 2 mismatches: GAGCGCCATCTGTTCCTTGTCGAGCAACATACGACGCACAGGGTCTTGAC TGTCGAGCAGCATACGGCGCA

  9. Evaluation of Candidate Run Controls for Norovirus GII +

  10. Evaluation of Candidate Run Controls for Norovirus GII • Norovirus (previously known as the Norwalk-like viruses) is a common cause of gastroenteritis • Detection has traditionally relied upon EM • Two genetic clusters of NoV occur; GI and GII • Phase I of a study identified a suitable concentration of NoV GII isolate to use as a candidate run control l • Faecal norovirus (GII) sample was obtained • Sample was disrupted using glass beads in 10 mM Tris-HCl, pH 7.4 containing 2% FCS, & treatment with chloroform, from which a virus stock was prepared

  11. Norovirus GII Results Phase I * One or more replicate tested negative

  12. Evaluation of Candidate Run Controls for Norovirus GII • This has been distributed to 15 laboratories for on going analysis • Standards will eventually be -marked

  13. Lab H failed to detect NoV GII Norovirus GII Phase II

  14. Future Work Clinical panels have been proposed that include: CSF HSV-1, HSV-2, HCMV, EBV, VZV enterovirus, paraenterovirus Transplant HCMV, EBV, adenovirus Genital HSV-1, HSV-2, Treponema (ulcer) Eye swabs HSV-1, HSV-2, VZV, adenovirus, Chlamydia

  15. Future Work cont. Gastroenteritis NoV, astrovirus Respiratory Influenza A (H1, H3), influenza B, parainfluenza, RSV…… Vaginal swabs HSV-1, HSV-2, N. gonorrhoea, M. genitalis, C. trachomatis Urethritis N. gonorrhoea, M. genitalis, C. trachomatis

  16. Proposal Prepare International Standards for HCMV and EBV

More Related