From Gene to Protein

1. From Gene to Protein Protein Synthesis: How a cell makes a protein

2. Gene: Basic Unit of Hereditary Information Gene- segment of DNA that codes for a particular protein “Master Plans” for Proteins What is a gene?

3. RNA (Ribonucleic Acid) • RNA is a nucleic acid that is made up of repeating nucleotides • How does RNA’s structure differ from DNA’s structure? • Uracil replaces Thymine • Ribonucleic Acid has Ribose sugar instead of deoxyribose sugar • RNA is single stranded

5. Types of RNA • mRNA: Messenger RNA • RNA nucleotides in a single chain • Carries genetic information from DNA in nucleus to the cytoplasm • tRNA: Transfer RNA • Single chain about 80 nucleotides long that is folded into a hairpin/ clover shape • Specific amino acids are bonded to each RNA molecule (about 45 types of RNA) • rRNA: Ribosomal RNA • Make up the ribosomes

6. Created in the nucleus Single Stranded 3 Nucleotides together= Codon We’ll learn about these later MRNA

7. Transcription • DNA can’t leave the nucleus, so how should we get our information to the ribosomes to make proteins? • Make A Copy! • Transcription is the process of making RNA • Through Transcription the genetic information is copied from DNA into mRNA and our “blueprint” for proteins can leave the nucleus

8. Steps of Transcription • Making mRNA from a template strand of DNA • Only one strand serves as a template

9. Steps of Transcription • The area where transcription begins is the promoter • In Eukaryotes, this is the beginning of one gene • RNA polymerase binds to the promoter region on the DNA and begins adding complementary nucleotides • Complementary base pairs laws still apply. Remember that Uracil replaces Thymine • A=U • G=C

10. Steps of Transcription • Transcription will continue until RNA polymerase reaches a signal on the DNA template to stop= Termination Signal • At the termination signal, the newly formed RNA molecule is released • We typically think of mRNA going through Transcription, but all types of RNA are made this way.

11. Products of Transcription • Make the mRNA strand to complement this DNA template T C T A C T G A G T A G A U G A C U C A

12. After mRNA is transcribed…. • mRNA moves through the pores of the nuclear membrane into the cytoplasm of the cell • Now we can start making proteins! • Where does the cell make proteins?

13. Protein Synthesis (Translation) • The cell will make proteins based on the instructions that were coded in the DNA and transcribed in the RNA • What are proteins? • Made of chains of Amino Acids that are linked together by peptide bonds • There are only 20 amino acids • Each protein can be made of hundreds or thousands of amino acids • The code of a protein determines how it will fold and what its function will be

14. Why do cells make proteins? • What do proteins do? • The function of a protein depends on its structure • Proteins do almost everything! They make up the your structure, help chemical reactions occur (enzymes), carry messages throughout your body (hormones), and help protect your body (antibodies). • Proteins are so important to functioning. Before DNA was discovered to be the code of life, scientists thought proteins were the hereditary information.

15. Translation • The process of “translating” the language of DNA into the language of proteins • Something in the original DNA will signal what amino acids need to be placed and in what order • Our result is a protein!

17. Codons (mRNA) • The genetic information necessary for making proteins is encoded in series of three mRNA nucleotides= CODON • Each codon codes for a specific amino acid • To determine what amino acid the mRNA codon codes for we use a chart

19. Reading the Codon Chart • You are NOT responsible for knowing the names of the Amino Acids. • Notice how several codons correspond to the same amino acids • Often, the third letter in the codon is most important for determining what amino acid we need • Some codons don’t code for an amino acid. We need messages to tell the ribosomes when to start and stop

20. Let’s Practice! • Create an protein from this strand of mRNA AUG AGU UCA UUA GGG UGA

21. Find AUG

22. AUG AGU UCA UUA GGG UGA Start- Serine –Serine- Leucine- Glycine- Stop

23. Central Dogma of Genetics

24. Creating a Protein • Now we know what amino acids we need to string together to make our protein, but how do we get our amino acids? • tRNA (transfer RNA) will bring our amino acids to the ribosome

25. tRNA • tRNA is shaped like a clover leaf or a hairpin • There is a region where the amino acid attaches • There is also a region that recognizes the mRNA codon =Anticodon

26. Codon-Anticodon • The tRNA anticodon is a three nucleotide sequence that is complementary to the mRNA codon • The pairing of anticodon with codon ensures that the amino acids are added to the polypeptide chain in the way coded for in the mRNA

27. Translation • mRNA codon CUA codes for the amino acid Leucine. • tRNA molecule with the anticodon region GAU bonds to the mRNA • This RNA molecule is attached the a Leucine molecule • Leucine is added to the polypeptide • The same process occurs until all amino acids have been added to the protein

28. tRNA and Anticodons Make a Protein! mRNA: AUGCCUUGGCGCGGUGUUUGA UAC GGA ACC GCG CCA CAA ACU START LEU TRY ARG GLY VAL STOP

29. Ribosomes • Remember, protein synthesis occurs in the ribosomes • Ribosomes are composed of rRNA and proteins Can you identify z? What does y represent?

31. Protein Assembly • Protein Assembly occurs when a ribosomes attaches to the start codon on an mRNA molecule • The ribosome moves along the DNA strand as tRNA molecules bind to the mRNA molecule • Once the tRNA binds, it’s amino acid is added to the growing protein chain • Once the amino acid is added, the tRNA detaches from the ribosome • Once the stop codon is reached, the ribosome detaches and the protein is released

35. Animations • http://www.biostudio.com/demo_freeman_protein_synthesis.htm • http://player.discoveryeducation.com/index.cfm?guidAssetId=0acb95b3-3d40-472d-9fdf-577b86d2d8f7

36. Review • What is a gene? • What is the function of mRNA? • The process of making RNA is called? • Proteins are important because…? • The organelle responsible for making proteins is…? • tRNA molecules contain what 2 features? • Converting the mRNA directions into a protein is called…?