1 / 18

Society, Biology and Computers

Society, Biology and Computers. Views from a Black Woman Scientist By Raquell Holmes. Research Asst. Professor Center for Computational Science Boston University. Financial Director Institute for African-American E-Culture. Overview. Biology and Society Interests of a student

chuck
Download Presentation

Society, Biology and Computers

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Society, Biology and Computers Views from a Black Woman Scientist By Raquell Holmes Research Asst. Professor Center for Computational Science Boston University Financial Director Institute for African-American E-Culture

  2. Overview • Biology and Society • Interests of a student • Biology and Computers • A changing profession • Computers and Society • Creating community and technology

  3. Starting Out • High School Interests: • Society, Math and Biology (Social arguments are often based on biology/science) • College thinking: • Jobs: Biology, Math and Sociology • Skills: Biology, Sociology • Money: Biology • Biology in college: • Little math required, few societal discussions

  4. Starting Out Graduate School: Cell Biology Mammalian Ovary: Cell Signaling and Adhesion Skills: General- inquiry, reading and interpretation Math- basic calculations, some statistics Computation-use of commercial tools.

  5. Needing More Personal: Create learning environments Increase role of technology Increase social concerns Job Market for Biologists- Fewer academic positions for experimentalists Increased need for computation

  6. Biology and Computers New ways of approaching life sciences.

  7. Theory Computation Experiment A New Way of Doing Science

  8. The “New Biology” Era Biology is an increasingly interdisciplinary science. The biggest revolutions in biology are emerging from engineering, technology & computer science. Genomics & Bioinformatics

  9. A genome can be viewed as a computer program…. …………………...GGAAGAACAGG TATAAGCAATTCAATAATTATTGATGGACCATCTCCGTATGTGACAATTATACATAAAGACCCAAATGGAACTGTTCTAGATGATACACTAGCATTAAGAGAAAAATTCGAAGAATCAGTCGATAAATACAAACTTCATTTTACTGGATTAATCGCTGACAAAATTGCAAAAGAAAAACTGAATACTTACGTCCTCACTTATAAAAAAGCAGACGAAGCTATGCCTGCAGACGAAGCTATGCCAACTGATGTACCTAGTACTTCTGTTACTGGATCAACAATGGCAAACGAGCAACCAGAAACTCGTCCTGCAAAAATCGCTCAACCCGCGATGGAAGAGACAGATACTGCTCACATATCGGGATCTGAACCACAGGCTGATACAACACAAGCTGATACTTCAAATTCAGAAAGTGTTCCATCAGAGACAACTAAAACAGTGGCTGAAAATAATCCGCAAGAAAGTGCAACAGCAGAGAAAAACGAGCAAGAAGTCGCCGAGACAACACCTCAAAATGGAGAAGTTGCAAAAGAAGCTCAACCAACTGTAGAAGCTAGCACTCAAACAAATGAAGTCGCCCAAAATGGAAGCGAAAAAGA……. ……. ……. ……. …….

  10. Bioinformatics premise: from codes to life Organism(Computer) Cell (Machine) DNA(Program)

  11. The conversion • Cell Biology--> Bioinformatics • Biological data placed in databases. • Computer Science, Computational Science and Biology in one. • Experimental--> Computational Skills • modeling, database, programming, algorithms

  12. Training Required Modeling Mathematics statistics, linear algebra, differential equations. Computer Science programming languages- Pearl, Java, C+, C++ Biology ecology, genomics, genetics, biochemistry, cell and developmental

  13. Computers and Society Who gets to play?

  14. Creation Design Development Decision Making Ownership Full Participation in IT means…

  15. To research, develop, and deploy advanced information technologies in concert with and in support of African-American communities. Institute for African American E-Culture

  16. iAAEC is an IT Research Community • Computer Scientists • Educators and Education Researchers • Cognitive Scientists • Social Scientists • Entrepreneurs • Youth and Students • Community Activists

  17. Culture Specific Approaches • Research: creating culturally dependent IT that works to bridge Digital Divide. • Development: creating communities across the Digital Divide that design, use and create technology.

  18. iAAEC  IT Development Zones • Create social and collaborative environments that support the development of communities that design, create, and assess culture-specific IT. • One example is the High Performance Computing Lab Restoration Project. http://family.bu.edu/hpcl/

More Related