How cells use DNA, part 2: TRANSLATION

1. How cells use DNA, part 2:TRANSLATION

2. An overview: In the process of translation in a cell, the transcribed message of mRNA is translated to a totally different ‘language’, that of protein. DNA & RNA are ‘written’ in very similar chemicals, but protein is ‘written’ in an entirely different ‘script’: amino acids. Most commonly, what comes to mind is the process by which we take ideas expressed in one language, & make them intelligible in another language. Often this means a change of script, from one we don’t understand to another we can read.

3. For Translation we need: • An ‘edited’ or ‘mature’ mRNA • Ribosomes • An unusual molecule, transfer or tRNA • Lots of available Amino Acids

4. The overall goal: • Use the DNA message that was copied out into mRNA to produce a polypeptide or protein. • This is the second part of the CENTRAL DOGMA • It relies on the GENETIC CODE.

5. The tRNA: • Acts as a ‘taxi’ for Amino Acids • Single stranded, but folded upon itself into a clover-like shape. • Able to bind to Amino Acids at one end, and to mRNA at the other. • The mRNA binding end has an ANTICODON. • Each Anticodon codes for a different Amino Acid.

6. The tRNA: • Amino acids bind at the 3’ end of tRNA. • This requires some ATP energy! • The Anticodon binds to a complementary codon sequence on the mRNA. • i.e. AUG codon = UAC anticodon

7. The Ribosome: • Site of translation • Can be free in the cytoplasm, or associated with the R.E.R., Golgi Body, or Nucleolus. • Two Subunits Lg/Sm • Able to bind mRNA • Binds tRNA at one of three sites: E (Exit), P (Peptidyl Aminoacyl) or A (Acetyl Aminoacyl)

8. The Ribosome: • The mRNA binds in the groove between the large & small subunits. • The first tRNA binds to the P Site. • A second tRNA binds to the A Site. • This brings the amino acids on each tRNA close enough to form a peptide bond. • As the ribosome shifts down the mRNA, the first tRNA is bumped into the E site & is released.

9. The Amino Acids: • 20 different Amino Acids • All have the same basic structure: central Carbon bound to a Hydrogen, an Amino Group (NH2) and Carboxyl Group (COOH) • The fourth bond Carbon makes is to a variablegroup, abbreviated ‘R’ • Each Amino Acid has a unique ‘R’ • Some are nonpolar & hydrophobic (orange), rest are polar/HPhilic • 2 are acidic, 3 are basic.

10. The Amino Acids: • During translation, the Amino Acids ‘meet’ at the ribosome • When they are brought close together (on the ribosome), the Amino Group of one reacts with the other’s Carboxyl Group. • In a dehydration synthesis reaction, a peptide bond forms.

11. Initiating Translation: • mRNA binds to the Ribosome • tRNA’s carrying amino acids arrive, binding anticodon to codon • Peptide bond forms between Amino Acids

12. Continuing the chain: • The ribosome now shifts 1 codon, moving the first tRNA into the E Site, the second into the P site, and opening the A site for a new tRNA to bind.

13. Continuing the chain: • Many ribosomes can bind to the same mRNA & translate it simultaneously, amplifying the amount of protein made.

14. Reading the mRNA: • Codons in the mRNA are ‘read’ in threes • Each three-base combination represents a specific amino acid, & matches a tRNA anticodon • Some amino acids have only one code; others have several • Thus, the code is redundant.

15. Different forms of the Code:

16. Different forms of the Code:

17. Different forms of the Code:

18. How the code works: The DNA Sequence: TAC AAA GCC TAG GAT ACA ATT Is translated to the mRNA sequence: AUG UUU CGG AUC CUA UGU UAA Which in turn encodes the following sequence of amino acids in a polypeptide: MET—PHE—ARG—ILE—LEU—CYS—(stop)

19. Wrapping things up: • There are three mRNA codons that signal the end of a protein • They are called STOP CODONS: UAA, UAG, UGA • *in DNA, these are ATT, ATC, & ACT. • When it reaches a stop codon, the ribosome releases the mRNA, & translation ends.

21. Try your hand at this: mRNA Sequence: AUGCCUCGCAAAGGUUGCCACGUAUAA Amino Acid Sequence: MET PRO ARG LYS GLY CYS HIS VAL Stop