Read pages 204-211, and answer numbers 18 – 22, and then numbers 2, 4, 7 in the Standardized Test Prep Section

1. Your Homework Tonight Honors Read pages 204-211, and answer numbers 18 – 22, and then numbers 2, 4, 7 in the Standardized Test Prep Section

2. JQ: If you were to wake up on a deserted island tomorrow, how would you survive?

3. Essential Question: How do organisms ensure their survival?

4. Atmosphere was filled with hydrogen cyanide, carbon dioxide, carbon monoxide, nitrogen, hydrogen sulfide & water vapor

5. Formation of Life Miller/Urey Experiment Recreated early Earth atmosphere & passed electric spark into environment.

6. 1st Some Organic molecules formed (Proteins, Carbs. Lipids & Nucleic Acids) – Molecules that make up living organisms.

7. 2nd Proteinoid Microspheres formed – grouping of organic molecules forming what looks like primitive cell.

8. 3rd RNA & DNA formed – molecules that describe how to make living organisms. DNA RNA

9. 3.5 bya fossils show presence of prokaryotic cells (cells w/o a nucleus). Why underwater? Formed in the absence of oxygen and underwater. (Chemosynthesis)

10. 2 Types of Prokaryotes: Archaea Bacteria Extremophiles Common Cold

11. Organisms then became photosynthetic = food & oxygen released into atmoshphere. Ozone Layer (O3) formed. What does the ozone layer allow organisms to do?

12. Oxygen rose and became deadly for organisms = change became a must. What could they do? Organisms learned to use oxygen to generate energy.

13. 2 bya Eukaryotic cells (cells with a nucleus) formed from the joining of several prokaryotic organisms (endosymbiotic theory).

14. Avatar Continued… Exploring Evolutionary Concepts

15. Questions to answer when watching the movie: Do you believe in soul mates? Do the navi believe in soul mates? Provide example(s). Do any of the ikran (banshee’s) look or act the same? Provide examples. Do any of the navi look or act the same? Provide examples. If any of the organisms from above look and act different develop an explanation as to why? Provide examples from the movie demonstrating how Jake is able to ensure the survival of his avatar.

16. Mountain Banshee Research As a young Evolutionary biologist you are on a quest to understand how organisms ensure their survival. To do this you will have to obtain one of the banshee eggs found within this room. Once found you will have to grow and test your banshee to understand it. Find an egg. Return to your seat. DO NOT OPEN THE EGG!

17. Mountain Banshee Research • Open your egg. • What is inside? • What do these codes do? • Compare with someone near you, are the codes identical? • How will you decode the language of the banshee’s genes?

18. Banshee Genome Inside your eggs there is a list of codes for 11 traits. Each trait has two sequences of DNA, representing homologous genes. To build your banshee you will have to decode the genes.

19. BACKGROUND • Genome – refers to the full diploid set of DNA for an organism • You can get a genome from almost every somatic cell in your body. • 3. Human Genome Project-completed in 2003

20. Do Now: Form two lines in the classroom. (Roughly 12 students in one line, and 12 in the other) Journal Question: (after the game is done) What is the purpose of this activity? Explain.

21. Telephone Game • Gather into two even lines. • To win the game, the last person in the line has to act out the message being passed along.

22. Telephone Game Scenario’s A) In order to get an A on this activity the last person in the line must hop to the front lab desk and open up the 2nd draw from the right side of the desk. Pull out an object and then bark like dog three times. When finished wink at the teacher with your left eye. B) In order to get an A on this activity the last person in the line must skip to the front of the room, turn around and face the desks. Locate the chair in the 4th row, 3rd column. Sit in the desk chair backwards and moo like a cow one time. When finished wink at the teacher with your right eye.

23. Telephone Game Questions • How important is effective communication in society? 2.Do you think your cells/molecules ever play the telephone game?

24. Journal Question: With the person sitting near you, describe the basic steps of transcription and translation Take out homework

25. Lets recall some information for a minute: • What is a gene? • What do genes code for? • What is the function of a protein (examples)? • What determines the function of a protein? • 5. What are all proteins made of?

26. Link to Animation (go to 7:06 – 17:33) How are proteins made? Proteins are created in two steps called transcription & translation. AKA: Gene Expression

27. Link to Animation STEP 1: Transcription Instructions on how to make the protein are copied from the gene into a messenger RNA molecule. (Make a “Xerox copy” of the gene)

28. What is RNA? RNA similar to DNA, BUT it is single stranded instead of double stranded. Monomer Unit:nucleotide {ribose sugar instead of deoxyribose, and Uracil (U) instead of Thymine (T)} Function:DNA’s helper – carries out DNA’s instructions for making proteins (mRNA, tRNA, rRNA)

29. Transcription -In Depth Transcription factor is a protein that binds to the Promoter to regulate transcription In many genes, Promoter begins with TATAAA sequence called TATA Box Once transcription factors are in place, RNA polymerase makes mRNA transcript

30. Transcription -In Depth Two types of Transcription factors: Activator: protein that recruits RNA polymerase to bind to the promoter Repressor: protein that blocks RNA polymerase from binding to the promoter

31. Transcription Practice DNA: GTTGAATAACTATAAACCCGCGC AATCTGGCTTACAGACTCCGGCCCATTGCGCCGCAGATTACT GENE:TACAGACTCCGGCCCATT Pre-mRNA: AUGUCU GAG GCC GGG UAA AUGUCU GAG GCC GGG UAA Pre-mRNA: Introns Exons

32. Transcription -In Depth 4. We now have pre-mRNA! The introns of Pre-mRNA must be removed (spliced out) by spliceosomes 5. mRNA leaves nucleus and travels to ribosome for translation

33. Spliceosomes in Action GENE:TACAGACTCCGGCCCATT AUGUCU GAG GCC GGG UAA Pre-mRNA: mRNA:AUGUCUGCCUAA Spliceosome

34. When does RNA polymerase stop transcribing the gene? • There are 3 sequence that end a gene: • ACT • ATT • ATC

35. Journal Question: As you come in take one of the packets from the front of the room. Working with a partner complete pages 1 & 2. Once finished we will reconvene up front and finish decoding your banshee genes and determine what it will look like and how it will act. Have fun and we shall talk in about 20 minutes.

36. Step 2: Translation *Goal is to read mRNA & construct the protein* • 1. mRNA is read by ribosomes in groups of 3 letters called codons. (AUG, ACC) • 2. Codontells tRNA which amino acid to get.

37. Translation Link to Animation Initiation How does translation begin? Elongation How does the ribosome help translation continue? 3. Termination How does the ribosome know when to stop the process of translation?

38. The Codon Chart

39. *Conclusions* Now, can you expand on your answers to the questions? “How does the telephone game relate to protein synthesis?” “What happens if the message changes in any step of the process?” “Are these changes good or bad?”

40. Journal Question: Are the enzymes in your body able to think? Explain.

41. Review Questions: How is a sex chromosome different from an Autosome? How many pieces of DNA does your banshee have? What is the diploid number for your banshee’s cells? How many homologous pairs of DNA does your banshee genome have? How was your banshee’s genome created?

42. Creating a Banshee Genome + = Female Banshee Egg Mom N = 4 Male Banshee Sperm Dad N = 4 Fertilized Banshee Egg 1st Cell Diploid Cell 2(4) = 8

43. Karyotyping Recall • Paired? • Banding? • Arrangement? • XX vs. XY? • How do sex cells compare?

44. Closer look at DNA in a Karyotype AAAAGGAATCGGATTGGGAATATAAATTAAAAACGAACCGTACCCCGTTTGTATTCGGACTAAAAGGCATTTACCCTATAAACAATGGGGGAAGGATACTTATTTCAGCGTCCCATCCAATGGGATATAAACGGATTGGGTACGGGAATACTGGACACGCAATGGGCCG CGGACTAAAAGGCATTTACCCTATAAATTAAAAACGAACTACCCCTCTGTTTGTATTAAAAGGAATCGGATTGGGAATATAAACAATGGGGGTACTTATTTCAGCGTCCCATCTATAAACGGATTGGGTACAAGACTGGACACGCAATGGGCCGC TACCCCGTTTGTATTCGGACT TACCCCTCTGTTTGTATT TACTTATTTCAGCGTCCCATC TACTTATTTCAGCGTCCCATC

45. Creating a Banshee Karyotype • Using your banshee genome identify homologous chromosomes. • Determine how long each piece homologous chromosome will be. Develop your own scale so that it can fit on one piece of paper. • Draw bands (genes) within the homologous chromosome. They will have to be scaled as well. • Insert the letter used to represent each gene in the bands. Be sure to use either upper of lower case. • Label the phenotype of each gene. b short B Long Body Length Long D Long D Long Wing Span Long/Long Y Yellow B Blue Color Pattern Yellow/Blue

46. JQ: Are we the product of nature, or nurture? Explain.

47. JQ: No Journal Question. Have a seat and take out the “Decoding the Banshee Genome” Packet

48. Journal Question: If you flip a coin 100 times, will you always get 50 heads and 50 tails?

49. NO Journal Question Today! Take some time to review for your quest! You will need a pencil.

50. What is the weirdest looking animal you have ever seen? Leafy Seadragon