University of Illinois at Chicago College of Engineering

1. University of Illinois at Chicago College of Engineering NanoEngineering Research Lab Applications of Colloidal Quantum Dots and Carbon Nanostructures Michael A. Stroscioa,b,c, and Mitra Duttaa,b Sun Ke,a Milana Vasudev,c Jun Qian,a Sicheng Liao,b Takayuki Yamanaka,a,* D. Ramadurai,c,** Hye-Son Jung,a Jianyong Yang,a A. Rauchura,a Yang Li,a University of Kentucky, September 24, 2008 aElectrical and Computer Engineering Department, U. of Illinois at Chicago (UIC), 851 S. Morgan Street, Chicago, Illinois 60607 bPhysics Department, U. of Illinois at Chicago, 851 S. Morgan Street, Chicago, Illinois 60607 cBioengineering Department, U. of Illinois at Chicago, 851 S. Morgan Street, Chicago, Illinois 60607 *Now at Northwestern U., M. Razeghi Group, **Now at EPIR, S. Sivananthan

2. Nano Engineering Research Laboratory University of Illinois at Chicago College of Engineering Integrating Nanostructures with Biomolecules: Tool for Studying Biomolecular Architectures • Capabilities for Integrating Nanostructures with Biomolecule • - Synthesis of Biomolecule-Nanostructure Complexes • - Nanostructures used --- CNTs and Quantum Dots (QDs in our arsenal --- Au, CdS, CdSe, CdSe-ZnS, CdTe, ZnO, PbSe, and TiO2) • - Biomolecules studies in our lab by linking with manmade nanostructures include a wide variety peptides (CGGGLDV, CGGGIKVAV, CGGGRGD, CGGGRGDS, CGGGDGEA, GRKKRRQRRR (TAT), CGGGRVDS, GGGC, and many more) and a large variety of single- and double-stranded DNA molecules including ---molecular beacons, short sequences such as TTTTTT, molecular junctions, and specialized sequences such as: Biomolecule Biomolecules Biomolecules Sequence  # 1: 5'-Carboxy dT GTATGATATGTTCCCTGGCTCTACTACTGGAGT -3'Sequence  # 2: 5'- ACTCCAGTAGAGCCTGGGAA -3'Second sequence (20 bases) is complementary to the first one (30 bases) from 3‘ end. WE WILL MAKE THESE CAPABILITIES AND OTHERS AVAILABLE TO MEMBERS OF THE BIOMOLECULAR ARCHITECTURE TEAM

3. Nano Engineering Research Laboratory University of Illinois at Chicago College of Engineering Integrating Nanostructures with Biomolecules: Relevances tp Biomolecular Architectures  Essential for understanding how environmental effect modify the vibrational, optical, and electronic properties of biomolecules - as an example vibrational modes are modified at boundaries between biomolecules and surfaces in contact with biomolecules (for optical modes boundary conditions such as electrostatic boundary conditions apply and for acoustic modes continuity of displacements and/or normal components of stress tensors) Au wire Background • Integrating nanostructures and biomolecules makes it possible to assemble arrays of structures --- possible coherence enhancements in scattering signatures • Our past work has exploited biomolecules to make ordered arrays of man-made nanostructures --- alternatively, nanostructures may be used to make arrays of biomolecules (possible enhancements of scattering signatures) New CdSe-ZnS-GGGC CdSe-ZnS CdS WE WILL MAKE THESE CAPABILITIES AND OTHERS AVAILABLE TO MEMBERS OF THE BIOMOLECULAR ARCHITECTURE TEAM

4. TiO2 Nanoparticles DNA strand NH2 NH2 NH2 NH2 NH2 NH2 NH2 NH2 NH2 NH2 NH2 NH2 NH2 NH2 NH2 NH2 NH2 NH2 Glutaraldehyde, cross-linker PMMA substrate modified with –NH2 group Schematic of Immobilized DNA Schematic representation of PMMA slides modified chemically to have –NH2 end groups and the DNA strands are attached via glutaraldehyde

5. ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC DNA strand NH2 NH2 NH2 N NH2 NH2 NH2 N NH2 NH2 NH2 N N N N N N N Glutaraldehyde, cross-linker PMMA substrate modified with –NH2 group Schematic of the DNA chemically bound to the PMMA sheets

6. ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC ACTCGAGTACAGCGACCCAACATGAGAGAAC DNA strand NH2 NH2 NH2 N NH2 NH2 NH2 N NH2 NH2 NH2 N N N N N N N PMMA substrate modified with –NH2 group Glutaraldehyde, cross-linker Yale-UIC Collaboration Illustration of DNA-based SAM fabricated for U. Va. The DNA strands for the formation of the monolayer on PMMA are: 5’- Amino AC TCG AGT ACA GCG ACC CAA CAT GAG AGA AC-‘3 and 3’- TG AGC TCA TGT CGC TGG GTT GTA CTC TCT TG carboxy Dt-‘5 The DNA strand with the amino modification on the 5’ end is the one attached to the PMMA substrate modified by hexamethylene diamine to have a-NH2 group and glutaraldehyde is used as the cross-linking agent. Carboxyl modified DNA was bound to the TiO2 particles via the dopamine modification. The two DNA strands are complementary to each other so they are hybridized to form a double stranded DNA monolayer.

7. 931 Sample #2: Double-stranded DNA /TiO2 (4.5μm) 1732 1101 1449 814 Raman spectrum from PMMA sample with double stranded DNA bound to TiO2 nanoparticles PMMA has its major peaks at 1100, 1430, 1780 cm-1 TiO(2) below 620 cm-1

8. Raman Spectrum of Single-stranded DNA on PMMA PMMA has its major peaks at 1100, 1430, 1780 cm-1 PMMA sample with single stranded DNA * Spectral measurements by Jianyong Yang

9. Raman Spectroscopy Raman Spectra were obtained using the Renishaw Raman imaging microscope with an argon ion (514.5 nm) laser and the data is recorded using a CCD camera. A B 560 810 598 1454 1098 959 1746 984 835 563 1728 940 1448 1190 1075 1615 1240 815 1110 1310 Raman spectra of DNA immobilized on PMMA substrate (a) single stranded amine modified DNA (35 bases) (b). Amine modified GAPDH DNA (850 bp)

10. Raman Spectroscopy Raman Spectra were obtained using an (325 nm) laser and the data is recorded using a CCD camera. Raman spectra of DNA immobilized on PMMA substrate with a SAM of amine modified GAPDH DNA (850 bp)

11. Raman Spectroscopy Raman Spectra were obtained using an (325 nm) laser and the data is recorded using a CCD camera. Raman spectra of DNA immobilized on PMMA substrate with a SAM of amine modified GAPDH DNA (850 bp)

12. Summary The table shows the Raman lines from the various samples. Ar-ion-laser plasma lines and background have not been removed.

13. University of Illinois at Chicago College of Engineering Nano Engineering Research Laboratory DNA Identification with Molecular Beacons

14. This concentration can be increased to 10:1 of gold NP to quantum dots The concentration of the beacons to the quantum is adjusted to be 3:1 so that the quenchers can effectively quench the fluorescence from the dots The control experiment with a different DNA strand needs to be performed University of Illinois at Chicago College of Engineering Nano Engineering Research Laboratory DNA Identification with Molecular Beacons

15. Left-handed Z-DNA is a higher-energy form of the double helix. Each time a right-handed DNA segment turns into Z-DNA, two B–Z junctions form.

16. DNA strands partially complementary to each other are used to form I DNA structure for the study of B-Z transitions. When B-Z transition occurs in presence of higher salt concentrations, the quantum dot fluorescence is quenched due to the contact with the quencher, BHQ1; quenching range of the BHQ1 is 480-580 nm I shaped DNA Structure for the study of B-Z DNA transitions Representation of I DNA structure with the Quantum dot and quencher attached to opposite ends

17. I shaped DNA Structure for the Study of B-Z DNA Transitions • DNA strands partially complementary to each other are used to form I DNA structure for the study of B-Z transitions. • When B-Z transition occurs in presence of higher salt concentrations, the quantum dot fluorescence is quenched due to the contact with the quencher, BHQ1; quenching range of the BHQ1 is 480-580 nm TCCTGCTCTC AGGACGAGAG GC CG GTGTGCTTGT CACACGAACA QD, Luminescent TiO2 Quencher Representation of I DNA structure with the Quantum dot and quencher attached to opposite ends

18. I. Red Curve in Figure 2; B DNA in cacodylate buffer 50 mM NaCl 2.5 mM MgCl2 II. Purple Curve in Figure 2; Z DNA in cacodylate buffer 50 mM NaCl10 mM MgCl20.125 mM Co(NH3)6Cl3 III. Green Curve in Figure 2; B DNA in cacodylate buffer 25 mM NaCl1.0 mM MgCl2 IV. Blue Curve in Figure 2; Z DNA in cacodylate buffer 25 mM NaCl5 mM MgCl20.0625 mM Co(NH3)6Cl3 TCTTGCTCTC--QUENCHER AGAACGAGAG GC CG GC GTGTCGTTGT CACAGCAACA—QD I-shaped DNA structures with a quencher and a quantum dot (QD) bound to adjacent arms of the structure. The GC-GC-GC linkers undergo pH control- led B- to Z-DNA transitions and move quenchers relative to quantum dots

19. Raman spectra in the region 300-1800 cm-1 of B and Z forms of poly(dG-dC).poly(dG-dC) and their difference spectrum. Benevides and Thomas, Nucleic Acids Research, 1983

20. Nano Engineering Research Laboratory University of Illinois at Chicago College of Engineering Study of DNA Using Indirect Bandgap Semiconductor Quantum Dots • Michael A. Stroscio and Mitra Dutta, “Biologically-inspired Chemically-directed Self-assembly of Semiconductor Quantum-dot-based Systems: Phonon-hole Scattering in DNA Bound to DNA-quantum-dot Complexes,” International Journal of High Speed Electronics, 16(2), 659-668 (2006). • Bykhovskaia, Gelmont, Globus, Woolard et al., Prediction of DNA Far-IR Absorption Spectra based on Normal Mode Analysis, Theor. Chem. Acc., 106, 22 (2001). • Dimitri Alexson, Hongfeng Chen, Michael Cho, Mitra Dutta, Yang Li, Peng Shi, Amit Raichura, Dinakar Ramadurai, Shaunak Parikh, Michael A. Stroscio, and Milana Vasudev, “Semiconductor Nanostructures in Biological Applications,” Journal of Physics: Condensed Matter, 17, R637-R656 (2005) T. Yamanaka, M. Dutta, T. Rajh, and M. A. Stroscio, “Phonon Absorption and Emission by Holes in the HOMO Bands of Duplex DNA,” Proceedings of the International Conference on Hot Carriers in Semiconductors, Proceedings of the International Conference on Hot Carriers in Semiconductors, in Nonequilibrium Carrier Dynamics in Semiconductors, Springer Proceedings 110, 225-228 (2006).  1D Model for Deformation Potential Scattering of Holes in DNA  Experimental Studies of Carrier-Phonon Interactions in DNA

21. Introduction ~ Polaron drift model in DNA ~ Polaron Drift It has been reported that a polaron in DNA is spread over 6~7 base-pairs. DNA might be characterized as a continuous media. E. M. Conwell and S. V. Rakhmanova, Proc. Natl. Acad. Sci. USA, 97, 4556 (2000); Michael A. Stroscio and Mitra Dutta, “Biologically-inspired Chemically-directed Self-assembly of Semiconductor Quantum-dot-based Systems: Phonon-hole Scattering in DNA Bound to DNA-quantum-dot Complexes,” International Journal of High Speed Electronics, 16(2), 659-668 (2006).

22. 1D quantum wire model based on the optical deformation potential Phonon scattering rates are calculated for 1D wire model based on the optical deformation potential. It means Assumptions DNA is a 1D chain which consists of base pairs. All bases have same mass. The cross section is a rectangle shape. The elastic constant is identical along the chain.

23. Phonon-like mode in DNA Some researchers have reported phonon-like mode in the region of ~20 cm-1. For example, Urabe et al. reported 14 cm-1 . H. Urabe and Y. Tominaga, Biopolymers., 21, 2477 (1982) This energy looks so small. But, from the basic model of 1D chain Sound velocity along DNA was reported : 1.9 km/sec M. B. Hakim, S. M. Lindsay, and J. Powell, Biopolymers., 23, 1185 (1984) 1.74 meV is also a reasonable value.

24. Quantum Dot Interactions with DNA DNA IP and Semiconductor Ev

25. Phonon scattering rates with broadening. Polaron scattering with the expected longitudinal acoustic phonon mode with a frequency of 14 cm-1 ( = 1.74 meV) evaluated in the Fermi Golden Rule approximation

26. Scattering Rates for Different Effective Mass Absorption Rate Emission Rate Ephonon = 1.74 meV Dop = 0.03x1010 eV/m s = 1.0 meV

27. Theoretical model • Characterization of the charge transport in DNA based on phonon scatterings. • Phonon scattering rates are calculated by the Fermi golden rule and the deformation potential. • Especially in DNA, phonon scatterings are important on being trapped by an energy valley, typically, G, GG, or GGG site. The charge movement through DNA starting at position x=0 and illustrates the distance over which charges are transferred.

28. Monte Carlo Simulation 1 Simulation of drift The space is simply one-dimensional without boundaries. The initial energy is 25.9 meV. Simulation setup 1

29. Simulation Result 1 Evaluation of the drift velocity Eini = 25.9 meV F = 5.8x105 V/m No boundary Average position

30. Simulation Result 2 (Evaluation of meff) Drift velocity calculated by Conwell is 17.4 m/sec. S. V. Rakhmanova and E. M. Conwell, J. Phys. Chem. B., 105, 2056 (2001) meff = 50 ~ 60 is very general value. Saturation velocity due to the effective mass

31. Monte Carlo Simulation 2 Simulation of diffusive behavior The space is 1D with the boundary at x = 0. The initial energy is 25.9 meV. meff is assumed to be 50. No electric field Simulation setup 2

32. Simulation Result 3 Demonstration of diffusive behavior Eini = 25.9 meV No electric field Boundary at x = 0 meff = 50 Rapid transfer for a long range was demonstrated.

33. Comparison to the Reported Experimental Result Unfortunately, it is difficult to evaluate carrier dynamics directly from experiments. This weak distance dependency implies rapid charge transfer. This agrees with our demonstration One of the representative results Giese et al., Nature, 412, 318 (2001)

34. Charge transfer through DNA via TiO2(titanium dioxide)nanoparticles has been studied in the past. TiO2 is a IV-VI semiconductor which has its excitation and emission frequencies in the UV range. Charge Transfer in DNA When excited via UV light, TiO2 has excess of holes (charges) which can be transferred to DNA due to the match in their energy levels • Tijana Rajh et al., J Phys. Chem. B, 2002.

35. Gel Electrophoresis to Detect Cleavage 5’ COOH TGTATGATATGTTCCCAGGCTCTACTGGAGT AAGGGTCCGAGATDACCTCA 5’ Lane 1: DNA/TiO2 before illumination with UV light Lane 2: DNA/TiO2 illuminated with 365 nm UV for 15 min. The Gel clearly shows two separate bands and suggests that cleavage has occurred Lane 3: Unconjugated DNA oligo (Control). It is evident from the Gel that Lane 1 and 3 have the same molecular weight and hence proves that the TiO2 does not get into the gel and affect the DNA. Lane 5: 25 bp DNA ladder: 500, 200 125, 75, 50, and 25 bp 1 2 3 5 Nanocomposites used for oligonucleotide cleavage experiments were TiO2/30 sense 5’Carboxy dT GTATGATATGTTCCCAGGCTCTACTGGAGT and antisense oligo TiO2/30 antisense 5’ACTCCAGTAGAGCCTGGGAA

36. Three-Dimensional DNA Networks • The three sequences used to form the junction are: • # 1 : 5’-COOH TCTGAGGA • # 2 : 5’ GAGACAGA • # 3 : 5’ TCCTCGTCTC • The TiO2 is attached to the 5’ end of sequence #1. • Should be noted that the three-way junction is a T junction . Two arms are symmetric about the junction TiO2

37. Theoretical model • Characterization of the charge transport in DNA based on phonon scatterings. • Phonon scattering rates are calculated by the Fermi golden rule and the deformation potential. • Especially in DNA, phonon scatterings are important on being trapped by an energy valley, typically, G, GG, or GGG site.

38. u1 = u2 T1normal = T2normal u = 0 clamped Tnormal = 0 free-standing Monoatomic chain Diatomic chain Dispersion --- monoatomic chain Dispersion --- diatomic chain Dispersion curve for M1=M2=M Folding the dispersion curve

39. DNA is considered as a one-dimensional chain. If the base sequence is completely random, the number of phonon modes should become a number of base pairs. However, each base pair have almost same mass and it is considered that phonon modes in DNA can be discussed based on a monoatomic chain model. In monoatomic chains, at the zone edge. At the same time, the sound velocity is represented by at k = 0 As a result, the angular frequency becomes

40. The sound velocity of B-DNA has been measured as 1.9 km/sec [1], and the period of bases is 3.4 Å. Therefore, 3.68 meV corresponds to 29.61 cm-1. This value is the energy of the phonon mode at the zone edge in the case of a uniform one-dimensional chain. However, if the periodic perturbation is assumed with a period of 2a, this energy becomes the energy of the optical mode at the zone center as discussed above. And if the perturbation is more complicated but still weak at the same time, which means that the discussion based on monoatomic chains is still valid, it is expected that another optical modes appear below this energy. In fact, it has been reported that the lowest lying mode in B-DNA is 14 cm-1 (=1.74 meV) [2]. As a result, it can be said that there is the mode in DNA with only a few meV. [1] M. B. Hakim, S. M. Lindsay, and J. Powell, ‘The Speed of Sound in DNA’, Biopolymers, 23, pp. 1185-1192, 1984 [2] H. Urabe and Y. Tominaga, ‘Low-Lying Collective Modes of DNA Double Helix by Raman Spectroscopy’, Biopolymers, 21, pp. 2477-2481, 1982

41. Measuring I-V Characteristics in ssDNA TiO2 Light h+ h+ h+ h+ h+ h+ e- DNA Quantum Dot AFM - cd TTTTTT Au Au ssDNA TiO2 Dopamine or 3,4 dihydroxyphenylethylamine Au Glass

42. I-V Characteristics of Nanostructure Interface Au-TiO2-Au without UV Light Au-TiO2-Au with UV Light TiO2 Light For EF at mid-gap Current sensing AFM h+ h+ h+ Au e- For FN near Ec Quantum Dot For FP near Ev Au

43. I-V Curves for a Au-Ti02-Au Ec = - 4.2 eV Ev = - 7.4 eV E0 = - 6.2 eV E0 = - 6.6 eV E0 = - 7.0 eV E0 = - 7.4 eV

44. u1 = u2 T1normal = T2normal u = 0 clamped Tnormal = 0 free-standing Monoatomic chain Diatomic chain Dispersion --- monoatomic chain Dispersion --- diatomic chain Dispersion curve for M1=M2=M Folding the dispersion curve

45. DNA is considered as a one-dimensional chain. If the base sequence is completely random, the number of phonon modes should become a number of base pairs. However, each base pair have almost same mass and it is considered that phonon modes in DNA can be discussed based on a monoatomic chain model. In monoatomic chains, at the zone edge. At the same time, the sound velocity is represented by at k = 0 As a result, the angular frequency becomes

46. The sound velocity of B-DNA has been measured as 1.9 km/sec [1], and the period of bases is 3.4 Å. Therefore, 3.68 meV corresponds to 29.61 cm-1. This value is the energy of the phonon mode at the zone edge in the case of a uniform one-dimensional chain. However, if the periodic perturbation is assumed with a period of 2a, this energy becomes the energy of the optical mode at the zone center as discussed above. And if the perturbation is more complicated but still weak at the same time, which means that the discussion based on monoatomic chains is still valid, it is expected that another optical modes appear below this energy. In fact, it has been reported that the lowest lying mode in B-DNA is 14 cm-1 (=1.74 meV) [2]. As a result, it can be said that there is the mode in DNA with only a few meV. [1] M. B. Hakim, S. M. Lindsay, and J. Powell, ‘The Speed of Sound in DNA’, Biopolymers, 23, pp. 1185-1192, 1984 [2] H. Urabe and Y. Tominaga, ‘Low-Lying Collective Modes of DNA Double Helix by Raman Spectroscopy’, Biopolymers, 21, pp. 2477-2481, 1982

47. Phonon scattering rates with broadening. Polaron scattering with the expected longitudinal acoustic phonon mode with a frequency of 14 cm-1 ( = 1.74 meV) evaluated in the Fermi Golden Rule approximation

48. Intrasubband Intersubband (a) Slab, (b) Reformulated, (c ) Guided, (d) Bulk