280 likes | 497 Views
Making Sense of DNA. DNA is a code for making proteins. DNA (Gene) Protein Trait. Dilemma. Protein Made by ribosomes Ribosomes stuck in cytoplasm. DNA Contains sequence for protein Risky/Dangerous for DNA to leave nucleus. Solution– SEND MESSENGER!. Step 1- Copy DNA Info on mRNA.
E N D
DNA is a code for making proteins DNA (Gene) Protein Trait
Dilemma Protein • Made by ribosomes • Ribosomes stuck in cytoplasm DNA • Contains sequence for protein • Risky/Dangerous for DNA to leave nucleus
Step 1- Copy DNA Info on mRNA • DNA creates a message for the ribosome called mRNA. • Messenger RNA (mRNA): • Same structure as DNA (except different type of sugar; ribose instead of deoxyribose)
Step 1- Copy DNA Info on mRNA • DNA creates a message for the ribosome called mRNA. • Messenger RNA (mRNA): • Same structure as DNA (except different type of sugar; ribose instead of deoxyribose) • Single stranded
Step 1- Copy DNA Info on mRNA • DNA creates a message for the ribosome called mRNA. • Messenger RNA (mRNA): • Same structure as DNA (except different type of sugar; ribose instead of deoxyribose) • Single stranded • Uracil replaces all the thymines.
Step 1- Copy DNA Info on mRNA • Write the corresponding RNA strand TAAGCTACCGAATGGACAACACTTCGACTA AUUCGAUGGUUACCUGUUGUGAAGCUGA
Step 1- Copy DNA Info on mRNA • Transcription video • http://www.youtube.com/watch?v=ztPkv7wc3yU
Step 1- Copy DNA Info on mRNA Similarities between DNA and RNA: 1. Sugar and phosphate make up the backbone 2. They both have base pairs 3. They both carry the same protein messages
Step 3- mRNA attaches to ribosome at START codon (AUG) • Ribosome finds the START sequence in the mRNA: AUG
Remember? • Ribosome- ___________________
Remember? • Ribosome- makes protein
Step 4- tRNA brings the correct amino acid • Each sequence of 3 bases corresponds to 1 amino acid • Codon- sequence of 3 bases that codes for an amino acid
Step 4- tRNA brings the correct amino acid • Transfer RNA (tRNA)- brings amino acids to the ribosome.
(Why sequence of 3?) • There are 20 common amino acids. • Could you make 20 different combinations with 2 bases? • How many different combinations can you make with 3 bases?
Step 5- Amino Acids link to form Protein • tRNA brings the next amino acid. • Peptide bonds- connect amino acids together to form a protein • Protein- chain of amino acids that fold into a specific shape.
Step 6- tRNA reaches STOP codon • The process continues until the STOP codon: UAG, UAA, UGA • Then the protein is complete.
Putting it all together • Video 1 • Video 2
Ticket • How does the DNA code get to the ribosome? • Which amino acid would match the mRNA code: CCA?
Practice DNA code: TACGTTCGAATT mRNA code: Amino acid code:
Project-Based Assessment #3 Project choices: Cancer (any genes)