Genetics and Recombinant DNA

1. Genetics and Recombinant DNA BIT 120

2. Cotton Pests • Cotton Bollworm

3. Cotton Pests • Cotton Leaf Perforator

4. How Do Farmers Deal With Pest Insects? • Chemical Control • Biological Control

5. Recombinant DNA • Definition : DNA molecule produced artificially and containing sequences from unrelated organisms. • Genetic Engineering • Use of techniques involving recombinant DNA technology to produce molecules and/or organisms with new properties. • Biotechnology • All inclusive term for several technologies including but not limited to recombinant DNA. Refers to the use of technology in applications for solving fundamental problems in biology.

6. Restriction endonucleases • Also called restriction enzymes: digest DNA at specific sequences

7. Sequence Recognition -R.E. • · Restriction endonucleases -- cut double stranded DNA at specific sequences, protection against viruses in bacteria. • · Sequences often palindromes: a sequence which is the same when read in either direction. ”A man a plan a canal: Panama”

8. Some common Restriction enzymes

9. Restriction digests and agarose gels - orientation

10. DNA ligase • · DNA ligase joins 5'-phosphate and 3'-hydroxyl ends of DNA • · Two fragments formed by EcoRI can be rejoined by ligase. • Similarly, Eco RI fragments from two different pieces of DNA can be joined

11. Ligation

12. Plasmids • · Extrachromosomal, circular small (2-3 kb) DNA in a bacterial cell which can replicate independently but which cannot integrate into the host chromosome. • · Drug resistance plasmids are not essential for the cell's growth, but confer antibiotic resistance. • · Plasmids used for molecular cloning have been artificially created by recombining fragments of various existing plasmids. • · Plasmids contain multiple cloning sites with several restriction endonuclease sites.

13. Example of a Plasmid

14. Example of a plasmid + insert (DNA of interest)

15. Tools of recombinant DNA - cloning

16. Creating a Recombinant DNA molecule • · A plasmid (vector) is digested with EcoRI at a single site to produce two sticky ends. • · A sample of human DNA is also digested with EcoRI to produce pieces with the same sticky ends • · Human DNA- or cDNA copied from mRNA using reverse transcriptase from retroviruses. • · The two samples are mixed and allowed to hybridize, some molecules will form with pieces of human DNA inserted into the plasmid vector at the EcoRI site. • · DNA ligase is used to covalently link the fragments.

17. Recombinant DNA molecule

18. Inserting recombinant DNA into Host • Transformation • cell made competent to take up DNA • competent cells: electroporation – poke holes in membrane and calcium chloride- make cells more permeable to DNA • Transfection • when the cloning vector used has aspects of a virus, the host cell can be infected (transfected) to insert the recombinant molecule • Electroporation • the cell is placed in an electric field such that small pores are temporarily opened in the membrane. Added DNA can enter through these pores.

19. Transformation

20. Selection • Antibotic resistance • · Plasmid vector contains an ampicillin resistance gene making the cell resistant. • · Growth of transformed cells (cells receiving the plasmid) can be identified on agar medium containing (e.g.) ampicillin.

21. Transformation

22. Further selection • · The plasmid vector contains another identifiable gene (e.g., a second drug resistance or an enzyme activity), with the coding sequence of this gene containing the restriction site for insertion. • · Insertion of the foreign DNA at this site interrupts the reading frame of the gene and result in insertional mutagenesis. • · In the following example, the -galactosidase gene is inactivated. The substrate "X-gal" turns blue if the gene is intact, ie. makes active enzyme. White colonies in X-gal imply the presence of recombinant DNA in the plasmid.

23. X-gal selection

24. Cells ready for DNA uptake • Competent cells: Treat the cells with calcium chloride which makes the cell membranes more permeable to DNA. This technique succeeds with species that aren't naturally competent e.g. E. coli. • Electroporation - alternate method

25. Finding the proper orientation of clone • Insert can go in both directions • How to determine correct orientation • Perform restriction digests using enzymes outside the cloning fragment • Add total fragments up • Must add up to right size

26. Link to Orientation • http://homepages.strath.ac.uk/%7Edfs99109/BB211/RDTSampleAnswers.html

27. Finding the right Clone • Hybridization (see overhead as well)

28. Genomic library • Source of DNA to clone • all the cells in your body have identical DNA • problem with this method is introns

29. Genomic Library Construction

30. cDNA libraries: alternate source(complimentary DNA library) • Made from RNA by reverse transcription (reverse transcriptase is enzyme) • RNA made into double stranded DNA • comes from tissue that expresses gene(s) of interest • no introns • source abundant in message • difficult to work with- RNA degrades more rapidly than DNA

31. cDNA library construction - step 1

32. cDNA library construction - step 2

33. cDNA library construction - step 3

34. Alternate cloning tool - PCR • Polymerase chain reaction • amplification of small DNA quantities • clone from genomic or cDNA source • thermostable polymerase - heat to separate DNA strands

35. PCR step 1: Denaturation

36. PCR step 2 - Annealing

37. PCR step 3 - Extension

38. After one round of PCR

39. After 2 rounds of PCR

40. After 3 round of PCR

41. Required Components of PCR • DNA template DNA • thermocycler (or water baths) • pool of free dNTPs • Taq (or other heat-stable) DNA polymerase • Primers - annealed at appropriate temperatures

42. Conditions for PCR • Denature: 94C to 100C , 1 minute • For anneal temperature, 2C for every A and T, 4 C for every C and G. 1minute - 2 minutes - GO 3-5 DEGREES BELOW THAT TEMPERATURE • Extension: 72 C for 2 minutes • Do this 30 cycles • machine programmable

43. Problem • What is the annealing temperature for the following primer (a 21 mer)?: AAGCTTGTCCAGAATTTCGGC

44. Solution • 11 A/T X 2 = 22 • 10 C/G X 4 = 40 • 22 + 40 + 62 • Go a few degrees below that number, so you would anneal at about 58C

45. Applications of recombinant DNA • Diagnosis of genes by RFLP (restriction fragment length polymorphisms) • Example sickle cell anemia

46. RFLPrestriction fragment length polymorphism converts a GAG codon (for Glu) to a GTG codon for Val abolishes a sequence (CTGAGG, which spans codons 5, 6, and 7) recognized and cut by one of the restriction enzymes.

47. Other diseases identified by RFLP • Cystic fibrosis • Huntington’s disease • Loss (or gain) of restriction enzyme sites when amino acid change in middle of codon, and thus, protein

48. How do you know sequence of DNA? • Sanger sequencing - named after Fred Sanger • utilizes 2',3'-dideoxynucleotide triphospates (ddNTPs), molecules that differ from deoxynucleotides by the having a hydrogen atom attached to the 3' carbon rather than an OH group. (see upcoming figure)

49. Sanger (dideoxysequencing) sequencing • Need polymerase • dNTPs • ddNTPs • primer • DNA template

50. Sanger method