1 / 2

Supplementary Figure 1

Supplementary Figure 1. Wild-type HI-loop sequence :. 5’-GAC ACA ACT. CCA AGT GCA-3’. D T T. P S A. Oligonucleotide (SYENFSA) insertion:. Csp45I. SYENFSA. SpeI. 5’-GAC ACA ACT TTC GAA TCG TAT GAG AAT TTT AGT GCG ACT AGT CCA AGT GCA-3’. D. T. T. F. E. S. Y. E.

earl
Download Presentation

Supplementary Figure 1

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Supplementary Figure 1 Wild-type HI-loop sequence : 5’-GAC ACA ACT CCA AGT GCA-3’ D T T P S A Oligonucleotide (SYENFSA) insertion: Csp45I SYENFSA SpeI 5’-GAC ACA ACT TTC GAA TCG TAT GAG AATTTTAGT GCG ACT AGT CCA AGT GCA-3’ D T T F E S Y E N F S A T S P S A Oligonucleotide (IVRGRVF) insertion: Csp45I IVRGRVF SpeI 5’-GAC ACA ACT TTC GAA ATT GTT CGTGGTCGG GTG TTT ACTAGT CCA AGT GCA-3’ D T T F E I V R G R V F T S P S A Random oligonucleotide insertions: Csp45I Randomized oligonucleotide SpeI 5’-GAC ACA ACT TTC GAA NNK NNK NNK NNKNNKNNK NNK ACT AGT CCA AGT GCA-3’ D T T F E X X X X X X X T S P S A Modified HI-loop sequences in adenovirus genome. In the adenovirus library, 21bp of random oligonucleotides were inserted between Csp45I and SpeI sites in the HI-loop of fiber coding region. In AdDCAR-SYE and AdDCAR-IVR, oligonucleotides (TCGTATGAGAATTTTAGTGCG: SYENFSA, ATTGTTCGTGGTCGGGTGTTT: IVRGRVF) were inserted, respectively.

  2. Supplementary Figure 2 PC3 AsPC-1 Day 3 30 Day 3 60 Day 5 Day 6 25 50 Day 7 Day 9 20 40 30 15 Relative adenovirus DNA 20 10 10 5 0 0 AdDCAR AdDCAR -SYE Ad-EGFP AdDCAR AdDCAR -SYE Ad-EGFP Replication of adenovirus DNA in infected cells. PC3 or AsPC-1 cells were infected with AdDCAR, AdDCAR-SYE and Ad-EGFP at MOI of 30. Cells were harvested at each day and genomic DNA was extracted for quantitative PCR analysis of fiber knob and cellular GAPDH (730 Real Time PCR System: Applied Biosystems, Foster City, CA). The amount of capsid DNA in each sample was normalized to GAPDH at each time point, and compared with adenovirus DNA at day 3.

More Related