TRANSLATION: information transfer from RNA to protein

1. TRANSLATION: information transfer from RNA to protein the nucleotide sequence of the mRNA strand is translated into an amino acid sequence. This is accomplished by tRNA and ribosomes. The amino acid sequence is encoded in the nucleotide sequence mRNA strands usually have an AUG sequence which means start and end with UAA, UAG, or UGA (stop). AUG always means methionine, it also means START. As a consequence, all polypeptides begin with methionine, at least initially. The initial methionine is trimmed off in most polypeptides later. There are three stop codons, which are not associated with amino acids. They cause the polypeptide to be released by the ribosome. the reading direction is 5’ to 3’. Note also the importance of reading frame. It is essential that the ribosome begin reading at exactly the right position in the nucleotide sequence in order to create the desired protein.

2. The following sequence of DNA can be read in six reading frames.  Three in the forward and three in the reverse direction.  The three reading frames in the forward direction are shown with the translated amino acids below each  DNA seqeunce.  Frame 1 starts with the "a" Frame 2 with the "t" Frame 3 with the "g".  Stop codons are indicated by an "*" The longest ORF is in Frame 1.    5'                                                    3'    atgcccaagctgaatagcgtagaggggttttcatcatttgaggacgatgtataa 1 atg ccc aag ctg aat agc gta gag ggg ttt tca tca ttt gag gac gat gta taa     M   P   K   L   N   S   V   E   G   F   S   S   F   E   D   D   V   *  2  tgc cca agc tga ata gcg tag agg ggt ttt cat cat ttg agg acg atg tat      C   P   S   *   I   A   *   R   G   F   H   H   L   R   T   M   Y  3   gcc caa gct gaa tag cgt aga ggg gtt ttc atc att tga gga cga tgt ata       A   Q   A   E   *   R   R   G   V   F   I   I   *   G   R   C   I 

4. Ribosomes • Ribosomes are the organelle (in all cells) where proteins are synthesized. • They consist of two-thirds rRNA and one-third protein. • Ribosomes consist of a small (in E. coli , 30S) and larger (50S) subunits. The length of rRNA differs in each. • The 30S unit has 16S rRNA and 21 different proteins. • The 50S subunit consists of 5S and 23S rRNA and 34 different proteins. • The smaller subunit has a binding site for the mRNA. The larger subunit has two binding sites for tRNA.

6. tRNA • Transfer RNA (tRNA) is basically cloverleaf-shaped. • tRNA carries the proper amino acid to the ribosome when the codons call for them. • At the top of the large loop are three bases, the anticodon, which is the complement of the codon. • There are 61 different tRNAs, each having a different binding site for the amino acid and a different anticodon. • For the codon UUU, the complementary anticodon is AAA. • Amino acid linkage to the proper tRNA is controlled by the aminoacyl-tRNA synthetases. • Energy for binding the amino acid to tRNA comes from ATP conversion to adenosine monophosphate (AMP).

7. Two models of tRNA.

8. Translation • Polymerization process, consisting of initiation, elongation and termination. • process of converting the mRNA codon sequences into an amino acid sequence. • The initiator codon (AUG) codes for the amino acid N-formylmethionine (f-Met) in proks. No transcription occurs without the AUG codon. f-Met is always the first amino acid in a polypeptide chain, although frequently it is removed after translation. • Small ribosome unit binds IF1 and 2 then in the presence of GTP binds fmet tRNA.

10. Initiation 3 IF factors IF1 and 3 cause ribosome to dissociate into 50S and 30s They bind to 30S IF2 binds to incoming fMet tRNA together with GTP The incoming mRNA binds to the 30S unit. It is lined up correctly by the Shine Dalgarno sequence in the mRNA (-10) which is complimentary to a sequence of rRNA The fmet tRNA then binds to the 30s ribosome unit where the IF 1 and 3 and mRNA are already bound This is the initiation complex The 50S ribosome unit then binds to this intiation complex The 50S unit has 3 sites, P (peptidyl), A (amino acyl) and E (exit). When the initiation complex and the 50S come together the fMet aligns with the Psite. The anticodon end contacts the 30S and the acceptor the 50S

11. Elongation • P site is initially occupied by fmet in the initiation complex. • The second amino acid binds at the A site. • The code on the tRNA binds to the complimentary code on the messenger RNA • GTP and 2 elongation factors( EfTu and EFT) guide the amino acyl tRNA in and align the codon. • GTP is hydrolysed and EFTu dissociates • EFT is involved with regeneration of EFTU-GTP complex.

12. New tRNAs bring their amino acids to the open binding site on the ribosome/mRNA complex • a peptide bond is formed between the amino acids, catalysed by peptidyl transferase • Uncharged tRNA moves from P to E sites • peptidyl tRNA moves from A to P • The complex then shifts along the mRNA to the next triplet, opening the A site. • The new tRNA enters at the A site.

15. Regeneration of EF-Tu-GTP by Tu-Ts exchange.

16. A schematic view of functional regions of the ribosome.

18. Termination • When the codon in the A site is a termination codon,(UAA, UAG, UGA) a releasing factor binds to the site, stopping translation and releasing the ribosomal complex and mRNA. • 3 different release factors, RF1,2 and 3 • RF not only block A site but affect the bond between the tRNA and the growing chain which is broken releasing the peptide • Often many ribosomes will read the same message • a structure known as a polysome forms

19. The 70S ribosome is now unstable in the presence of a protein called ribosome recycling factors, as well as the initiation factors IF3 and IF1. Consequently, the 70S ribosome dissociates to 50S and 30S subunits and is ready for another round of translation. When the ribosomal subunits separate, the 30S subunit may not always dissociate from its mRNA. For example, in polycistronic messages (more than one protein coded on an mRNA), the 30S subunit may simply slide along the mRNA until the next Shine-Dalgarno sequence and initiation codon are encountered and begin a new round of translation.