DNA Transcription and Translation

1. DNA Transcription and Translation Sections 12.3 and 12.4

2. Do Now • 1. What is RNA • 2. How does it differ from DNA? • 3. What is protein?

3. Gene • Segment of DNA that codes for a protein • DNA codes for RNA and RNA makes protein

4. One Gene – One Enzyme • The Beadle and Tatum experiment showed that one gene codes for one enzyme. • One gene codes for one polypeptide. • polypeptide - a chain of covalently bonded amino acids. • (proteins are made of one or more polypeptide)

6. 12.3 DNA, RNA, and Protein

7. Let’s make some observations about RNA’s structure

8. RNA • RNA stands for: • Ribonucleic acid • RNA is found: • Nucleus and Cytoplasm

9. RNA Structure • Like DNA, RNA is made up of subunits called _____________, which are made of three parts: • Sugar (ribose) • Phosphate • Nitrogen Base

10. RNA’s Nitrogen Bases • Adenine (A) • Cytosine (C) • Guanine (G) • Uracil (U)

11. There are 3 types of RNA: • Messenger RNA (mRNA) • Ribosomal RNA (rRNA) • Transfer RNA (tRNA)

12. All RNA is … • Single stranded • Many different shapes • “Cheap copy” of DNA

14. Do Now • 1. What is a protein made of? • 2. Explain the process between DNA and proteins.

15. Transcription • First step in making proteins • Process of taking one gene (DNA) and converting into a mRNA strand • DNA -> RNA • Location: • Nucleus of the cell

17. Steps to Transcription • 1. An enzyme attaches to the promoter (start signal region) of a gene and unwinds the DNA

18. Steps to Transcription (Cont.) • 2. One strand acts as a template.

19. Steps to Transcription (Cont.) • 3. A mRNA copy is made from the DNA template strand by RNA polymerase • 4. A mRNA copy is made until it reaches the termination (stop signal) sequence • 5. The two strands of DNA rejoin.

20. Template vs. Non Template Strand

23. Transcription animations • http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html • http://www.fed.cuhk.edu.hk/~johnson/teaching/genetics/animations/transcription.htm

24. Transcribe this DNA to mRNA

26. Think- Pair- Share • 1. Where in the cell does transcription occur? • 2. What nucleic acids are involved in the process of transcription? • 3. What is the importance of transcription? • 4. In transcription, how come the whole DNA molecule is not copied into mRNA? • 5. How does one gene differ structurally from another? • 6. Because one gene differs from another, what molecules in the cell will also be different?

27. mRNA Processing • Pre-mRNA – the original sequence of RNA created during transcription • mRNA reaches the ribosomes

28. RNA Processing

29. What is RNA Processing? • After transcription the pre-mRNA molecule undergoes processing • 5’ cap is added • Poly A tail is added to the 3’ end • Introns are removed.

30. Do Now • Label the Transcription diagram

31. RNA Processing • In Eukaryotes only • Introns- non-coded sections • Exons- codes for a protein • Before RNA leaves the nucleus, introns are removed and exons are spliced together • A cap and poly A tail are added to ends of the sequence • mRNA leaves the nucleus through the nuclear pores

32. Why is it necessary to add the poly A tail and 5’ cap?

33. Let’s try an activity (11.5) • http://www2.pearsonsuccessnet.com/snpapp/iText/products/0-13-115075-8/index.html

35. Pg. 339 • Pg. 339

36. 3’ CAUGAUGUACGAUACGUA 5’ cap Let’s an example… • Original DNA Sequence (DNA): • 5’ GTACTACATGCTATGCAT 3’ • Translate it (RNA): • 3’ CAUGAUGUACGAUACGUA 5’ • Add the 5’ cap:

37. Add a poly A tail onto the 3’ end Poly A tail 3’ CAUGAUGUACGAUACGUA 5’ 3’ CAUGACGGUA 5’ 3’ CAUGACGGUA 5’ cap cap cap Finish the job! • Remove the introns “UGUA” and “AUAC”:

38. Get a new partner! • DNA Strand of non-template strand: • 5’ ATCGGTAGAGTATTTACAGATA 3’ • Remove introns: • CGGUA UUACAG

39. Think, Pair, Share • Take a minute think on your own, then pair with your partner, and share your ideas! • Evolutionary, why do you think there are introns? • Where did they come from? • Why do we have them? • Remember there is NO wrong answer!

40. PROTEINS!

41. Proteins are made up of amino acids!!! • Proteins are polymers of amino acids • Only 20 different amino acids • BUT there are hundreds of thousands of different proteins How can this be?

42. Let’s compare to it to the English language • How many letters are in the alphabet? A,b,c,d,… 26 • How many words are there? Miss, Ings, is, smart, .. Almost infinite! • Each word has a unique structure of letters. • Similar to proteins and amino acids

43. Proteins- (PCFNa) -made of 20 different Amino Acids - Amino Acids bond to form polypeptide chains

44. How do amino acids form these peptide chains? Peptide Bonds – Link each amino acids together to form proteins

45. How many amino acids are in a dipeptide chain? How about a tripeptide chain? How many water molecules are formed from 2 amino acids? How many water molecules are formed from 100 amino acids?

46. Do Now • Perform transcription on this DNA segment: GCTTCATACGA • Do RNA processing and remove the introns: GAA and UGC • How does this mRNA sequence leave the nucleus? • Where does it go?

47. Protein Structure http://www3.interscience.wiley.com:8100/legacy/college/boyer/0471661791/structure/HbMb/hbmb.htm

49. Translation • Production of proteins from mRNA • mRNA goes to the ribosomes in the cytoplasm or the RER and produces proteins