120 likes | 282 Views
Initiation: (on your own sheet of paper). What do you know about DNA? Have you ever seen DNA being used on TV or in movies? Why do you think it is important to study DNA?. Key Points Nucleotides are the building blocks of DNA.
E N D
Initiation: (on your own sheet of paper) What do you know about DNA? Have you ever seen DNA being used on TV or in movies? Why do you think it is important to study DNA?
Key Points • Nucleotides are the building blocks of DNA. • Nucleotides are made of a Sugar, Phosphate, and Nitrogenous Base. • DNA is made of four types of nucleotides; Adenine, Thymine, Cytosine, and Guanine. • Each nucleotide binds specifically with another nucleotide. Adenine binds to Thymine and Cytosine binds to Guanine. • DNA has a double helix structure. SWBAT: Describe the overall structure of the DNA molecule.
Nucleotides are the building blocks of DNA. Nucleotide Nucleotide Nucleotide Nucleotide Nucleotide
Nucleotides are made of aSugar,Phosphate, and NitrogenousBase. Phosphate Nitrogenous Base Sugar
DNA is made of four types of nucleotides; Adenine, Thymine, Cytosine, and Guanine. Each nucleotide binds specifically with another nucleotide. Adenine binds to Thymine and Cytosine binds to Guanine. Adenine Thymine Adenine Thymine Cytosine Guanine Guanine Cytosine
Hemoglobin TACCAAGTAGAATGAGGACTTCTCTTTTCACGACAGTGGCGGGAGATACCATTCCATCTACACCTGCTTCAACCGCCTCTACGTAATCCAGCAAACATC • Hemoglobin is a special protein found in our red blood cells. • This protein allows our RBC’s to carry oxygen. • Mutations in this protein can lead to Sickle Cell Anemia.
Build our own DNA!!! Your table will be responsible for building part of the hemoglobin DNA strand. Identify your sequence of DNA. Gather materials: Toothpicks Gum Drops licorice ropes Assign colors to specific nucleotides Example: red = thymine 3. Build your DNA!
Termination: Look at this single stranded segment of hemoglobin DNA… TGAGGAC What do each of the letters represent? Write out the sequence of the complimentary strand. Which part of the nucleotide is responsible for bonding with another nucleotide? When these two strands are put together, what does the overall structure of the DNA molecule look like?
Initiation: Nucleotides are the building blocks of ______________. Nucleotides are made of a ________, ____________, and ________________. DNA is made of four types of nucleotides; __________, ______________, ____________, and ____________. Each nucleotide binds specifically with another nucleotide. ____________ binds to _____________ and __________ binds to ____________. DNA has a __________ _________ structure.
Berry Full of DNA!!! Mash the strawberries into a slush. 2. Add detergent solution. 3. Filter the strawberry extract. 4. Layer the cold ethanol over filtered extract.
Termination: The first 12 nucleotides for that code for the hemoglobin protein are… TACCAAGTAGAA What is a nucleotide? Draw the basic structure and label its parts. What is the sequence of the complimentary DNA strand? T/F The structure of DNA is called a single helix (If false, change one word to make it true)