1 / 46

Transcription

Transcription. … from DNA to RNA. http://www.hhmi.org/biointeractive/media/DNAi_transcription_vo1-lg.mov. From Gene to Protein Part 2. Goal 1- Understand the process of transcription How is RNA made? How to get from DNA to RNA Goal 2- Demonstrate how RNA is made

garima
Download Presentation

Transcription

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Transcription … from DNA to RNA http://www.hhmi.org/biointeractive/media/DNAi_transcription_vo1-lg.mov

  2. From Gene to ProteinPart 2 Goal 1- Understand the process of transcription How is RNA made? How to get from DNA to RNA Goal 2- Demonstrate how RNA is made Transcription- Model activity

  3. Try This! • Molecular Genetics Alphabet Online Activity • Crack this code DNA nucleotide triplet ACG Cys

  4. Recap: From Gene to Protein Part 1 • What are the two main processes linking gene to protein? “Cookbook” (genotype) “Copy of recipe” “Dish” (phenotype)

  5. The Central Dogma of Molecular Biology DNA RNA Protein transcription translation replication

  6. Why RNA?

  7. Why RNA? • Not all genes need to be turned on at once. • We can make an RNA transcript of just ONE GENE • Now we can make the right protein at the right time in the right location

  8. Why RNA? In EUKARYOTES… • DNA cannot leave the nucleus • BUT proteins are built by the ribosomes in the cytosol! • We need a messenger to transfer the genetic code to the ribosomes

  9. mRNA • Messenger RNA (mRNA) is a complementary copy of a gene that CAN leave the nucleus

  10. Gaining Access to DNA

  11. 4 Phases of Transcription • Initiation • Elongation • Termination • Processing (Eukaryotes Only) • To make a copy you need 3 things: • Something to copy – DNA! (cookbook) • Something to copy with – Nucleotides! (ingredients) • Something to make the copy – Enzymes! (recipe)

  12. Goal: to express (turn on) Initiation (start) Green fluorescent protein DNA nucleotides 3’ 5’ DNA template (the “something” to copy)

  13. DNA nucleotides 3’ 5’ 1. DNA template (the something to copy) 3. RNA polymerase enzyme (the something to make the copy) RNA Polymerase II 2. RNA nucleotides (the something to copy with)

  14. Transcription factor Green fluorescent gene Promoter region Termination sequence 5’ 3’ Nucleotides (T-T-A-T-T-T) “TA-TA” box Transcription unit “Downstream” “Upstream” Bind/unwind DNA

  15. Initiation • RNA polymerase (RNAP) binds to the double stranded DNA molecule at a promoter sequence (with the help of initiation (transcription) factors) • It is able to locally unzip DNA with its own built in helicase activity as it constructs an RNA transcript of the DNA

  16. RNA Polymerase II

  17. Enhancers

  18. Promoters • DNA sequence upstream of the gene being transcribed • Determines where RNAP binds and where transcription begins • Usually rich in Thymine and Adenine (“TATA” box)

  19. 3´ 5´ A T G T G A C T A C G G G C C C C G P P P P P P P P P P P P P P P P P P S S S S S S S S S S S S S S S S S S 3´ 5´ Elongation • One strand of the unzipped DNA acts as a template for RNA synthesis Template Strand

  20. T C G G U C T G G A U C C A A G C G C G C T A G C C G P P P P P P P P P P P P P P P P P P P P P P P P P P P S S S S S S S S S S S S S S S S S S S S S S S S S S S 3´ 5´ Elongation 3´ 5´ Coding Strand 5´ 3´ Template Strand

  21. Elongation (strand) Green fluorescent gene 3’ 5’ Transcription factor 3’ 5’ Direction of RNA synthesis 5’ 3’

  22. Elongation • mRNA is transcribed in the 5' to 3' direction • DNA unwinds only in the region of transcription • After transcription DNA recoils • Several RNAPs can work on a single gene at once

  23. One more look at Elongation

  24. Termination • A terminator sequence on the coding strand tells RNAP when to stop transcribing the mRNA • RNAP is released and reused and mRNA is released

  25. Termination (stop) Green fluorescent protein Green fluorescent gene 5’ 3’ Transcription unit Termination sequence Transcribed (copied) 5’ 3’ messenger RNA (mRNA) Translated

  26. DNA transcription DNA transcription narrated

  27. Transcription Videos • mRNA synthesis • Stages of Transcription

  28. Processing • In Eukaryotic cells the RNA transcript is called pre-mRNA (or primary RNA) because it must still be modified before it leaves the nucleus • Why processing? • Remove introns • Protects from degradation in the cytoplasm

  29. Introns and Exons Genes contain both coding regions (exons) and non-coding regions (introns)

  30. Introns and Exons • To produce a final mRNA transcript, introns must be removed

  31. Splicing

  32. Splicing • The Spliceosomeis a complex of multiple proteins (snRNPs) and small nuclear RNA (snRNA) • snRNA binds a specific mRNA sequences at the beginning and end of an intron forming a loop • The loop is removed and exons are linked

  33. G G G C U C G A U C G A A A A A A A G G A P P P P P P P P P P P P P P P P P P P P P S S S S S S S S S S S S S S S S S S S S S Cap and Tail 5´ 3´ cap mRNA transcript poly A tail

  34. Cap and Tail • To protect RNA from restriction endonucleases in the cytosol, a poly-A tail is added to the 3‘ end of the pre-mRNA • As an attachment site for the ribosome, a 5‘ cap of modified Gs is added

  35. Try your hand at this: • DNA Sequence: TACGGAGCGTTTCCAACGGTGCATATT mRNA Sequence: AUGCCUCGCAAAGGUUGCCACGUAUAA This code will determine the order of amino acids in a protein…

  36. Try it again, with introns! • DNA Sequence: INTRONS are red. TACTTGTTATAGTAGTAGGGAGCGCATCTGAAAAAATCGGCATTTCCACTTCTCGAAACCACCACGGTGCATTCCATT mRNA Primary Transcript: AUGAACAAUAUCAUCAUCCCUCGCGUAGACUUUUUUAGCCGUAAAGGUGAAGAGCUUUGGUGGUGCCACGUAAGGUAA mRNA Secondary Transcript: AUGAACAAUAUCCGCGUAGACUUUAAAGGUGAAGAGCUUUGGGUAAGGUAA

More Related