1 / 107

Introduction to DNA Lecture notes edited by John Reif from PPT lectures by:

Introduction to DNA Lecture notes edited by John Reif from PPT lectures by:. Natalia Tretyakova, College of Pharmacy, U. of Minnesota. Richard Lavery, Institut de Biologie Physico-Chimique, Paris. Image from http://zen-haven.dkhttp://zen-haven.dk. DNA Double helix

ghazi
Download Presentation

Introduction to DNA Lecture notes edited by John Reif from PPT lectures by:

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Introduction to DNA Lecture notes edited by John Reif from PPT lectures by: Natalia Tretyakova, College of Pharmacy, U. of Minnesota Richard Lavery, Institut de Biologie Physico-Chimique, Paris Image from http://zen-haven.dkhttp://zen-haven.dk

  2. DNA • Double helix • Stores genetic code as a linear sequence of bases • ≈ 20 Å in diameter • Human genome ≈ 3.3 x 109 bp • ≈ 25,000 genes Richard Lavery Institut de Biologie Physico-Chimique, Paris

  3. DNA Size Scale

  4. Chemical bond 1 Å (10-10 m) Amino acid 10 Å (10-9 m) Globular protein 100 Å (10-8 m) Virus 1000 Å (10-7 m) Cell nucleus 1 mm (10-6 m) Bacterial cell 5 mm (10-5 m) Chromosome DNA 10 cm (10-1 m) Biological length scale Richard Lavery Institut de Biologie Physico-Chimique, Paris

  5. DNA BASES

  6. The Building Blocks of DNA OH ribose H deoxyribose Nucleoside Nucleotide Richard Lavery Institut de Biologie Physico-Chimique, Paris

  7. Nucleotides are linked by phosphodiester bonds • Strand has a direction (5'3') • DNA is negatively charged on phosphate backbone. Richard Lavery Institut de Biologie Physico-Chimique, Paris

  8. C5 C4 C6 N7 C5 C6 N3 C8 N1 N1 C2 N9 C4 C2 N3 Purine (Pur / R) Pyrimidine (Pyr / Y) Base families Richard Lavery Institut de Biologie Physico-Chimique, Paris

  9. DNA and RNA nucleobases • (DNA only) • (RNA only) • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  10. Purine BasesThe 9 atoms that make up the fused rings (5 carbon, 4 nitrogen) are numbered 1-9. All ring atoms lie in the same plane. Richard B. Hallick Introductory Course in Biology or Biochemistry

  11. Purine Nucleotides • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  12. Pyrimidine BasesAll pyrimidine ring atoms lie in the same plane. Richard B. Hallick Introductory Course in Biology or Biochemistry

  13. Pyrimidine Nucleotides • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  14. nucleobase • (Deoxy) • nucleoside • 5’-mononucleotide • Adenine (A) • Guanine (G) • Thymine (T) • Cytosine (C) • Uracil (U) • 2’-Deoxyadenosine (dA) • 2’- Deoxyguanosine (dG) • 2’- Deoxythymidine • (dT) • 2’- Deoxycytidine • (dC) • Uridine (U) • Deoxyadenosine 5’-monophosphate • (5’-dAMP) • Deoxyguanosine 5’-monophosphate • (5’-dGMP) • Deoxythymidine 5’-monophosphate • (5’-dTMP) • Deoxycytidine 5’-monophosphate • (5’-dCMP) • Uridine 5’-monophosphate (5’-UMP) • Nomenclature of nucleobases, nucleosides, and mononucleotides • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  15. Structural differences between DNA and RNA • DNA • RNA • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  16. Deoxyribose Sugar The hydroxyl groups on the 5'- and 3'- carbons link to the phosphate groups to form the DNA backbone. Richard B. Hallick Introductory Course in Biology or Biochemistry

  17. Nucleosides • A nucleotide is a nucleoside with one or more phosphate groups covalently attached to the 3'- and/or 5'-hydroxyl group(s). Richard B. Hallick Introductory Course in Biology or Biochemistry

  18. Preferred conformations of nucleobases and sugars in DNA and RNA • Sugar puckers: • 5.9 A • 7.0 A • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  19. Nucleosides Must Be Converted to5’-Triphosphates to be Part of DNA and RNA • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  20. DNA BASE PAIRING

  21. Thymine -Adenine Cytosine -Guanine Watson-Crick base pairs Richard Lavery Institut de Biologie Physico-Chimique, Paris

  22. A-T and G-C Base Pairing Richard B. Hallick Introductory Course in Biology or Biochemistry

  23. Hydrogen bond donors and acceptors on each edge of a base pair • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  24. Purine always binds with a Pyrimidine Richard Lavery Institut de Biologie Physico-Chimique, Paris

  25. Base pair dimensions Richard Lavery Institut de Biologie Physico-Chimique, Paris

  26. DNA : A ,T,G,C + deoxyribose RNA : A,U,G,C + ribose DNA/RNA chemical structure Richard Lavery Institut de Biologie Physico-Chimique, Paris

  27. DNA BACKBONE STRUCTURE

  28. Helix Axis View: Backbone structure: • Alternating backbone of deoxyribose and phosphodiester groups • Chain has a direction (known as polarity), 5'- to 3'- from top to bottom • Oxygens (red atoms) of phosphates are polar and negatively charged • Bases extend away from chain, and stack atop each other • Bases are hydrophobic Richard B. Hallick Introductory Course in Biology or Biochemistry

  29. OnScreen DNA Model app

  30. B-DNA STRUCTURE

  31. Video of DNA Helix Structure: http://www.youtube.com/watch?v=ZGHkHMoyC5I Contains material from: Alberts, Bray, Hopkin, Johnson, Lewis, Raff, Roberts, Walter, Essential Cell Biology, Second Edition, Garland Science Publishing, 2004

  32. B-DNA Structure CGCGTTGACAACTGCAGAATC Richard Lavery Institut de Biologie Physico-Chimique, Paris

  33. Features of the B-DNA Double Helix • Two DNA strands form a helical spiral, winding around a helix axis in a right-handed spiral • The two polynucleotide chains run in opposite directions • The sugar-phosphate backbones of the two DNA strands wind around the helix axis like the railing of a sprial staircase • The bases of the individual nucleotides are on the inside of the helix, stacked on top of each other like the steps of a spiral staircase. Richard B. Hallick Introductory Course in Biology or Biochemistry

  34. B-DNA (axial view) Richard Lavery Institut de Biologie Physico-Chimique, Paris

  35. R.H. helix B-DNA (lateral view) Richard Lavery Institut de Biologie Physico-Chimique, Paris

  36. Base stacking: an axial view of B-DNA • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  37. PI Bonds – (Mechanism of PI Base Stacking)

  38. Forces stabilizing DNA double helix • Hydrogen bonding (2-3 kcal/mol per base pair) • Stacking (hydrophobic) interactions (4-15 kcal/mol per base pair) • Electrostatic forces. Comparison to other bonds • Covalent Bond Energies: • C-C 85 kcal/mol • C-O 87 kcal/mol • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  39. B-DNA • •Sugars are in the 2’ endo conformation. • •Bases are the anti conformation. • •Bases have a helical twist of 34.6º (10.4 bases per helix turn) • Helical pitch = 34 A • 23.7 A • right handed helix • helical axis passes through • base pairs • 7.0 A • planes of bases are nearly • perpendicular to the helix axis. • 3.4 A rise between base pairs • Wide and deep • Narrow and deep • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  40. DNA can deviate from the ideal Watson-Crick structure • Helical twist ranges from 28 to 42° • Propeller twisting 10 to 20° • Base pair roll • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  41. MAJOR MINOR DNA grooves Richard Lavery Institut de Biologie Physico-Chimique, Paris

  42. Major groove and Minor groove of DNA • N • NH • O • 2 • N • H • N • O • 2 • N • NH • N • N • N • HN • C-1’ • N • N • N • N • C-1’ • NH • O • O • 2 • C-1’ • Hypothetical situation: the two grooves would have similar size if dR residues • were attached at 180° to each other • To deoxyribose-C1’ • C1’ -To deoxyribose • C-1’ • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  43. N • NH • 2 • H • N • O • 2 • N • N • HN • C-1’ • N • N • NH • O • 2 • C-1’ • Major and minor groove of the double helix • O • N • NH • N • N • N • N • C-1’ • O • C-1’ • Wide and deep • Narrow and deep • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  44. B-type duplex is not possible for RNA • steric “clash” • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  45. A-DNA STRUCTURE

  46. De-hydration Hydration 3’ 5’ 5’ 3’ Antiparallel strands A B A and B DNA allomorphs Richard Lavery Institut de Biologie Physico-Chimique, Paris

  47. A-DNA (longitudinal view) Richard Lavery Institut de Biologie Physico-Chimique, Paris

  48. R.H. helix A-DNA (lateral view) Richard Lavery Institut de Biologie Physico-Chimique, Paris

  49. A-form helix:dehydrated DNA; RNA-DNA hybrids • •Sugars are in the 3’ endo conformation. • •Bases are the anti conformation. • •11 bases per helix turn • Helical pitch = 25.3 A • Right handed helix • planes of bases are tilted • 20 ° relative the helix axis. • 2.3 A rise between base pairs • 25.5 A • Top View • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

  50. The sugar puckering in A-DNA is 3’-endo • 5.9 A • 7.0 A • Natalia Tretyakova • College of Pharmacy, U. of Minnesota

More Related