1 / 7

Table S1 (Ho et al.)

Table S1 (Ho et al.). Table S1 Primers and their sequences used in this study. Name. Sequence. CDPK1. -. F. 1 5’. -. CTAC. AGATCT. ATGGGGAATCAGTGCCA. -. 3'. CDPK1. -. R. 1. 5'. -. TCAT. AGATCT. CTAAACTCCATTTTCACAGAT. -. 3'. CDPK1. -. F. 2. 5'. -. TCTAG.

gunnar
Download Presentation

Table S1 (Ho et al.)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Table S1 (Ho et al.) Table S1 Primers and their sequences used in this study. Name Sequence CDPK1 - F 1 5’ - CTAC AGATCT ATGGGGAATCAGTGCCA - 3' CDPK1 - R 1 5' - TCAT AGATCT CTAAACTCCATTTTCACAGAT - 3' CDPK1 - F 2 5' - TCTAG GGTACCGGATCC GATCGAGCGCGCGAGG - 3' CDPK1 - R 2 5' - CTCAA CTGCAG ATCCAACCCCCGCCTGAG - 3' GFP - F 3 5' - TCTAG CTGCAG GTGAGCAAGGGCGAG - 3' GFP - R 3.1 5' - TCTAG GTCGAC TTACTTGTACAGCTCGTC - 3' GFP - R 3.2 5' - TCTAG GTCGAC ACGCTGAACTTGTGGC - 3' GF14c - F 4 5' - TAA GGATCC ATGTCTCGGGAGGAGAAT - 3' GF14c - R 4 5' - TCA GGATCC TTACTGGCCCTCGCAGGCGT - 3' GF14c - F 5 5' - TCTAG GGTACCGGATCC ACGAGACCACTCGAACCCGACCCGCCTC - 3' GF14c - R 5 5' - ACCTTAGATT CTGCAG CAGTAGATGAG - 3' CDPK1 - F6 5’ - ATGGGGAATCAGTGCCAGAAC - 3’ CDPK1 - R6 5’ - AAGTTGTGCCAAACTGGCCCT - 3’ Gene accession numb er: OsCDPK1 (AY158077), GFP (U43284 ), OsGF14c (U65957). Restriction enzyme recognition sites are underlined. .

  2. Fig. S1 (Ho et al.) Fig. S1 Structure and amino acids sequence of OsCDPK1. Subdomains conserved in protein kinases are indicated by Roman numerals and underlined. Four EF-hand structures of calcium binding regions are indicated by dash underlines. Double dash underline indicates autoinhibitory regions of kinase activity. Green and red letters represent changes of amino acid residue from OsCDPK1 to OsCDPK12 and to OsCDPK13, respectively.

  3. Fig. S2 (Ho et al.) Fig. S2 Expression of OsCDPK1 in T4 transgenic rice. Total RNA was isolated from 14-day-old seedlings and subjected to Northern blot analysis using the OsCDPK1-specific probe. Ethidium bromide staining detected 25S and 18S rRNA bands. Lane 1, OsCDPK1 knockdown transgenic line (Ri-1); lane 2, OsCDPK1(tr) overexpressing transgenic line (OEtr-1); lane 3, wild-type (Wt).

  4. Fig. S3 (Ho et al.) A B 60 days Ri-5 OEtr-15 OEtr-6 Ri-4 OEtr-9 OEtr-4 Ri-3 OEtr-8 OEtr-3 Ri-2 Ri-1 OEtr-7 OEtr-1 Ri-1 OEtr-1 Wt Wt Ri- 1, 2, 3, 4, 5 OEtr- 1, 3, 4, 6, 7, 8, 9,15 • Fig. S3 • Comparison of plant height between T1 generation of OsCDPK1(tr) (8 independent lines) and OsCDPK1(Ri) (5 independent lines) and wild type (Wt) plants. • The independent T1 transgenic plants were corresponding to the transformed cell lines as showed in Figure 2, respectively, were grown in the isolated field for 60 days. (B) The T1 transgenic plants of OEtr-1 and Ri-1, and wild type plants were planted in an another isolated field and grown for 60 days.

  5. Fig. S4 (Ho et al.) A C 10 days +GA3 20.0 20.0 10 days 10 days -GA3 16.0 16.0 12.0 12.0 Length (cm) Length (cm) 8.0 8.0 4.0 4.0 0.0 0.0 Wt OEtr-1 Ri-1 Wt OEtr-1 Ri-1 D B Seedlings length (cm) Wt OEtr-1 Ri-1 Wt OEtr-1 Ri-1 Fig. S4 The semi-dwarf phenotype of the OEtr-1 line was recovered by GA3 treatment. Comparison of plant height between T4 generation of OEtr-1 and Ri-1 and wild type (Wt) plants. Seeds were germinating on medium containing1/2 MS salt and supplemented with (A and B) or without (C and D) 10 μM GA3 for 10 days.

  6. Wt Ri-1 OEtr-1 Fig. S5 (Ho et al.) OsCDPK1 GA20ox1 GA20ox2 GA3ox2 Act1 Fig. S5 The expression of GA biosynthesis-related genes in OEtr-1 and Ri-1 plants. Total RNA was isolated from 14-day-old seedlings and subjected to RT-PCR analysis using primers specific for OsCDPK1, GA20ox1, GA20ox2, and GA3ox2; the rice Act1 gene was used as an internal control.

  7. Wt GF14c-Ox GF14c-Ri Fig. S6 (Ho et al.) Fig. S6 Drought tolerance in transgenic rice is enhanced by overexpression of the 14-3-3 protein GF14c. Rice seedlings were grown on 1/2 MS agar medium for 14 days, transferred to the pot and grown for another 7 days, withheld water for 5 days, and re-watered for 4 days.

More Related