1 / 11

Lab 5 – Comparative Genomics

Lab 5 – Comparative Genomics. Annotating Retroelements. Dotter , identify direct and inverted repeats, and graphically visualize them. (R ough idea of coordinates – highlight in your sequence, and write it down to keep as your “map”)

gus
Download Presentation

Lab 5 – Comparative Genomics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Lab 5 – Comparative Genomics

  2. Annotating Retroelements • Dotter, identify direct and inverted repeats, and graphically visualize them. (Rough idea of coordinates – highlight in your sequence, and write it down to keep as your “map”) • TREP, identify the repetitive elements and their location in the sequence. (BLAST WHOLE Sequence. Remember to select the complete set and unselect the filter.) • Blast2sequencesbetween the two halves of the sequence, to more precisely identify the borders of the repeats (LTRs).

  3. Hwk 4 - Problem 4 Retroelement Annotation

  4. LTR Retroelement

  5. SOLO LTRs • For more information check section on Mobile Genetic Elements in Genomes3 by Brown: http://books.google.com/books?id=Cjl98tqp6rsC&lpg=PP1&pg=PA256#v=onepage&q=Mobile%20Genetic%20Elements&f=false

  6. TIRs Reverse complement GAGTAAAATGCAAGAAACCCACTTTGAAGGCTAGGTTTGCAGATAACACTACGTTACATTTTTTGGACAGAAAGCACCACGTCTCGTGTAATCTTGTTGCAAATAACACTGATTGGCGGATTAGAGCGCTTAAAGTATGTTTATGACAGGAGGGTCCAGATTTTGCCCTTGTGGCGTAACGGCTTGGCCATGACGGCGT ------> <------ ACGCCGTTTCGCCCCAAGCCGTTATGTCACATGGGCAAAATCTGGAACCACCTGTCATAAACACACTTAAAGCACTCTAATCCGCCAATCAGTGTTATTTGCAATAAGATTACACAAAACGTGATGCTTTTTGTTCAAAAAATGTAACGTAGTGTTATCTGCAAACCTAGCCTTCAAAATGGTGGTTTTATGCAATTTACTC

  7. FINAL RESULT Gypsy, WHAM SOLO LTR, Copia, WIS TIR, Mutator, Annie

  8. Annotating Complete Sequences • Dotter • TREP, Blast2sequences • BLASTX – sequence that does not include repetitive elements. Identify possible proteins in your sequence. • BLASTn – est_others, support predicted proteins with real ESTs • FGENESH+ – polish your gene borders and structure • BLASTp– validate your predicted protein with related one from BLASTx

  9. Hwk5 – Problem 5 – Complete Annotation

  10. FINAL RESULT

More Related