1 / 44

Non-codingRNA Paradigms in Medical Practice

CLL: THE INTERPLAY BETWEEN NON-CODINGRNAS AND PROTEIN-CODING GENES. Non-codingRNA Paradigms in Medical Practice. George Adrian Calin, MD, PhD Associate Professor Experimental Therapeutics & Cancer Genetics Depts. Co-Director, siRNA&ncRNA Center Univ. Texas, MD Anderson CC Houston, US.

hadassah-floyd
Download Presentation

Non-codingRNA Paradigms in Medical Practice

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. CLL: THE INTERPLAY BETWEEN NON-CODINGRNAS AND PROTEIN-CODING GENES Non-codingRNA Paradigms in Medical Practice George Adrian Calin, MD, PhD Associate Professor Experimental Therapeutics & Cancer Genetics Depts. Co-Director, siRNA&ncRNA Center Univ. Texas, MD Anderson CC Houston, US

  2. MIRNAS acting in nucleus (Hwang et al, Science 2007) MIRTRONS - nuclear pre-mRNA splicing (Ruby et al, Nature 2007; Okamura et al, Cell 2007; Berezikov et al, Mol Cell 2007) MiRNAs UPREGULATING translation (Vasudevan et al, Science 2008) MiRNAs targeting PROMOTERS of PCGS (Place et al, PNAS, 2008) Dicer MiRNAs targeting ORF of PCGS (Tay et al, Nature 2008) RISC RISC RISC RISC Cytoplasm miRNAs make big splash Genome - miRNA gene Pri-miRNA Drosha Nucleus Exportin-5 Pre-miRNA (hairpin precursor) Duplex miRNA mRNA cleavage Helicase Some miRNAs Translation repression 3’UTR ORF

  3. A model for HE-miRNA-mediated control of human hematopoiesis (Georgantas et al, PNAS 2007)

  4. miR-155 inhibited generation of myeloid and erythroid colonies by normal primary human CD34+ cells Normal PBSC CD34+ cells were transduced with FUGW (empty) or mir-155 lentivector. (A and B) Myeloid (A) and erythroid (B) colonies per 1,000 cells plated. (C) Representative colonies generated by control and mir-155-transduced cells. Results are representative of three separate experiments. (Georgantas et al, PNAS 2007)

  5. 60-70% of the human genome is transcribed, while the total fraction of bases occupied by known PCGS is only about 2% (Mattick & Makunin, Hum Mol Genet 2006) The non-codingRNA dictionary of the human genome

  6. Ultraconserved non-coding genes - the new chapter of the textbook 4 3 1 2 (Bejerano et al, Science, 2004)

  7. pancreas lung pancreas kidney breast breast kidney colon liver uc. 352(N) ~70bp ~20bp uc. 246(E) ~100bp ~70bp U6 ~20bp Ultraconserved genes - ncRNAs ubiquitously expressed (Calin & Liu & Ferracin et al, Cancer Cell, 2007)

  8. MICRORNAS AS ONCOGENES AND TUMOR SUPPRESSORS miRNAs as tumor sup pressors (e.g.miR-16/15a, let-7) and/or oncogenes (e.g. miR-155, miR-21, miR17-92 cluster, miR-372/373) (Johnson et al, Cell 2005; He et al, Nature 2005; O’Donnell et al, Nature 2005; Cimmino et al, PNAS 2005; He et al, Nature 2007; Chang et al, Mol Cell 2007; Voorhoeve et al, Cell, 2006; Raver-Shapira et al, Mol Cell 2007; Fabbri et al, PNAS 2007; Chang et al, Nat Genet 2008)

  9. D13S319 D13S1168 D13S1150 D13S272 D13S273 Telomere Centromere 0 100 200 400 500 600 700 1500 Kb 300 deleted region in CLL, MM Pr Ca, Pit Ad LEU 1 DLEU 7 NY-REN-34 antigen KPNA3 CLLD6 LEU 5 KCNRG LEU 2 CLLD8 CLLD7 ARLTS1 miR16-1 miR15-a Non-coding RNAs (ncRNAs) Protein coding genes (PCGs) A non-codingRNA revolution in the cancer society 13q14.3 in CLL (Calin et al, PNAS, 2002; Calin et al, N Engl J Med, 2005a; Calin et al, N Engl J Med 2005b)

  10. CLL 13qLOH 1 +/- 2 ND 3 +/- 4 +/- 5 +/? 6 +/+ 7 +/- 8 NI 9 +/+ 10 +/+ 11 +/+ 12 +/- 13 +/- 14 NI 15 +/- 16 +/- 17 +/- 18 NI CD5 + miR16 Mature miR miR15 Precursor Mature miR The LOH status for the presented samples is shown as: +/+ heterozygosity; +/- LOH; -/- homozygous deletion; NI not informative; ND not done. EtBr miR15a and miR16-1 are deleted or down-regulated in the majority of B-CLLs (Calin et al, PNAS, 2002)

  11. The Anatomy of CLL Genome Cinzia (Calin & Sevignani et al, PNAS, 2004)

  12. * B * C 2.5 6 Normal cytogenetics 2 5 13q-/- Tp53 protein Expression (R.U.) 1.5 4 Fold Induction (R.U.) 3 1 2 * * 0.5 1 0 Normal cytogenetics 13q-/- 0 miR-15a miR-16 TP53 Cytogenetic distribution and inverse correlation of miR-15a/16 and Tp53 in CLLs A (Fabbri and Botoni et al, submitted, 2009)

  13. BCL2 MCL1 BCL2 MCL1 miR-15a miR-16-1 13q 13qDEL miR-15a miR-16-1 17p 17pDEL TP53 TP53 miR-34b miR-34c miR-34b miR-34c 11q 11qDEL ZAP-70 ZAP-70 MicroRNA/Tp53 pathogenetic and prognostic model for CLL Normal B cell Malignant B cell (Fabbri and Botoni et al, submitted, 2009)

  14. GF GF Cell Contact Inhibition TGFb GF Deprivation Differentiation IRS1 RAS RAF CKIs (p21, p27, p57) MEK G1 miR-17~92 miR-106b~25 P P  CYC-CDKs ERK P RB SURVIVAL RESPONSES E2F E2F S INSENSITIVITY to ANTI-GROWTH SIGNALs SELF-SUFFICIENCY in GROWTH SIGNALS miR-124 ECM (laminin miR-140 miR-221/222 miR-106b/93 RTKs miR-143 miR-145 let-7 miR-15 miR-16 miR-34a miR-124 PI3K miR-29 miR-181 TCL1 AKT PTEN let-7 miR-34a miR-21 FAK let-7 MYC - let-7 HMGA2 Anchorage Independent Growth + ONCOmiR (Spizzo et al, Cell, 2009; Negrini et al, Current Oppin Cell Biol, 2009)

  15. LIMITLESS REPLICATIVE POTENTIAL EVASION FROM APOPTOSIS Unscheduled Proliferation Activated Oncogene DNA damaging agents Telomere Shortening miR-290 Epigenetic Telomere homeostasis Rbl1 let-7c miR-155 miR-150 miR-10a miR-144 DNMT3a/3b Death Receptors miR-29 Fas Tnf- Trail hTERT miR-148 FADD Caspase activation RB miR-372 miR-373 miR-106 miR-93 E2F miR-155 miR-21 miR-25 SENESCENCE APOPTOSIS LATS2 p21 TP53BP1 PDCD4 BIM  p16 Cyt C p53 BAX/BAD miR-34 miR-24 BCL2 MCL1 miR-34 BCL6 miR-15a miR-16 5’ 3’ miR-127 (Spizzo et al, Cell, 2009; Negrini et al, Current Oppin Cell Biol, 2009)

  16. Really?! Who are you little thing? The son of a new genetics? I am very small and non-coding! But I can do a big job in your cells! Size doesn’t matter! messengerRNAs microRNA

  17. MIRNA PROFILING AS A NEW DIAGNOSTIC & PROGNOSTIC TOOL FOR CANCER PATIENTS miRNAs expression signatures associated with diagnosis and prognostic factors (CLL, DLBCL, Lung, Colon, Pancreas, Brain ca.) (Michael et al, Molec Cancer Res 2003; Lu et al, Nature, 2005; Eis et al, PNAS, 2005 Lui et al, Cancer Res 2007, Bloomston et al, JAMA 2007; Mi et al, PNAS, 2007; Garzon et al, Blood 2008)

  18. 1.0 Patients without treatment (%) Long interval Short interval 0.8 0.6 0.4 0.2 0.0 Months A unique miRNA signature is associated with CLL progression (time from diagnosis to therapy) (Calin et al, N Engl J Med, 2005b)

  19. A unique miRNA signature is associated with CLL prognosis (Calin et al, N Engl J Med, 2005b)

  20. 104 pts MicroRNAs signature associated with 17p deletion in CLL patients 17pDEL (64 pts MDACC & CRC) FISH abnormal in 17p>20% cells (N=64) FISH abnormal in 11p, 12, 13q (N=43) KARYO abnormal (N=64) NORM/NORM (40 pts MDACC & CRC) normal FISH and normal KARYO (N=40)

  21. Associations Between miR-21 Expression in Tumors and Receipt of Adjuvant Chemotherapy With Prognosis (Schetter et al. JAMA 2008)

  22. Supervised (most significant 20 array probes) Unsupervised (all array probes) Supervised (array probes 0.01) Non-codingRNAfingerprints in ALL response to treatment

  23. Germline mutations? SNPpppppssssss? MicroRNAs? non-coding RNAs? What about human cancer! But who cares about tumors in mice?! Cancer susceptibility and non-codingRNAs (Calin et al NEJM, 2005, Raveche et al, Blood 2007, Sevignani & Calin et al, PNAS, 2007, Wu et al, Carcinogenesis 2008, Landi et al, Carcinogenesis 2008, Hu et al, JCI 2008, Jazdzewsky et al PNAS 2008)

  24. SUSCEPTIBILITY GENES (ex, APC, BRCA1, BRCA2) HEREDITARY (~5-10%) FAMILIAL (~20-30%) “MODIFIER” GENES (MOM1) SPORADIC (~60-75%) Cancer predisposition: from epidemiology to genetics A total of 1,444,920 new cancer cases and 559,650 deaths for cancer are projected to occur in US in 2007 (CA Cancer J Clin 2007; 57:53)

  25. A C miR-16-1 miR-15a P CD5 CD5 CLL CLL A U6 B D miR-16-1 miR-16-1 MEG01 cells mir-16-1 normal genome miR16-1 MUT miR16-1 MUT miR16 WT Empty V 293 miR16 WT Empty V 293 precursor miR-15a mir-16-1 (CtoT)+7 +7 +1 precursor U6 1.01 3.25 9.20 6.24 0.25 0.50 2.07 1.22 NB Ratio MAr Ratio 0.95 1.30 3.50 2.30 MAr Ratio 0.29 0.51 1.97 1.37 NB Ratio GFP Germline abnormalities in miR15a/miR16-1 transcript are associated with CLL and breast cancer aggregation (Calin et al, N Engl J Med, 2005b)

  26. About humans and mice: same gene - same mutation - same disease * NZB strain naturally develop CLL-like disease during aging; * Reduction of expression of miR-16 in hematopoietic tissues; * Mutation in mir-16 gene, in the same location as the germline mutation described in humans, found only in NZB strain

  27. Germline or Somatic mutations in Ultraconserved Genes in human cancers (Wojcik et al, Carcinogenesis, 2009)

  28. 133 cancer samples CLL CRC HCC UCG expression profiles classify human cancers * 50 UCRs differentiate human cancers (P<0.005) * half of them Non-exonic * 6/12 Exonic UCRs represent ANTISENSE transcripts with host gene (Calin & Liu & Ferracin et al, Cancer Cell, 2007)

  29. miR-155 expression Ucg3. expression UCG1 UCG2 miR-29b miR-155 expression Ucg2. expression miR-24-1 miR-155 UCG3 ZAP-70 positive CLLs Ucg.1expression miR-155 expression ZAP-70 negative CLLs miRNA::ncRNA interactions (Calin & Liu & Ferracin et al, Cancer Cell, 2007)

  30. 155 + UCG3 scr + UCG3 29b + UCG3 scr + UCG3 24 + UCG2 scr+ UCG2 155 + UCG1 UCG-miRNA direct interaction scr + UCG1 8 7 6 5 4 3 2 1 0 ncRNA::ncRNA interactions - miRNAs targeting UCGs 5’- ACTTCCCCCT:TCTATTA:TAGCATTAGCAACG ncRNA1 3’ -GGGGATAG:TGCTATACGTAATT miR-155 5’- TCAATGCACTATTGC:AAGAGCATTATTGCAT ncRNA2 3’ -GGGGATAG:TGCTATACGTAATT miR-155 5’- TGGAGATAC:AACAAGA:TAACATTAATGAGT ncRNA3 3’ -GGGGATAG:TGCTATACGTAATT miR-155 5’- CCGCCATGTACCTGC:CTACTTAGCCCAAGGG ncRNA2 3’- GACAAGGACGACTTGACTCGGT miR-24 5’- CTAATGAGACTGAGTTTACA::GTGCCATAGA ncRNA3 3’- TTGTGACTAAAGTTTACCACGAT miR-29b (Calin & Liu & Ferracin et al, Cancer Cell, 2007)

  31. Tumor-suppressor proteins AAAA AAAA AAAA AAAA AAAA AAAA NH2 NH2 COOH COOH AAAA PCG Deletion/Hypermethylation NH2 COOH AAAA miR Amplification Low apoptosis High proliferation Metastasis High angiogenesis AAAA AAAA PCG Mutation miR Translocation NH2 COOH NH2 COOH AAAA NH2 PCG Amplification miR Mutation COOH NH2 COOH NH2 COOH NH2 COOH  Oncogenic proteins AAAA miR Deletion/ Hypermethylation/ Abmormal processing PCG Translocation Causing miRNA abnormal expression - the combinatorial “in cascade”model (Calin & Croce, Cancer Res, 2006; Calin & Croce, J Clinical Inv 2007)

  32. MicroRNAs - the missing link in cancer predisposition (Calin & Croce, Nature Reviews Cancer, 2006)

  33. MICRORNAS AS NEW THERAPEUTIC TARGETS & NEW DRUGS

  34. me me miR-221 miR-222 Let-7 miR-126 HMGA2 RAS CRK unknown p27CIP/KIP1 CTGF TSP1 VEGF VEGF FGF SP HIF SPRED1 MYC EFRINA PIK3R2 Tumor cells Dissemination MicroRNAs - the micro-steering wheel of tumor metastases MAT Proliferation and motility at DISTANT SITES HOXD10 + TWIST miR-10b RHOC miR-335 miR-206 EZH2 Tight junctions ROCK miR-29c miR-101 TRAF6 IRAK RHOA miR-146 SOX4 TNC + miR-200 miR-205 miR-155 EMT Laminin  Collagen SMAD4 TGFb1 PTEN TPM1 RECK TIMP3 ZEB1 miR-373 miR-520 miR-21 miR-221 miR-222 C-KIT CDH1 MMPs CD44 miR-18 miR-19 let-7f miR-27b miR-126 OFF ZBTB10 Angiogenic Switch miR-27a miR-210 + miR-16 miR-15a miR-20a miR-20b HYPOXIA ON (Nicoloso et al, Nat Rev Cancer 2009)

  35. CLL B cells express constitutive levels of HIF-1alpha under normoxia and induces the VEGF expression pVHL is responsible of HIF-1 alpha degradation and is downregulated in CLL cells versus normal B cells miR-92-1 is overexpressed in CLL B cells and target pVHL and repress its expression Aberrant regulation of pVHL levels by microRNA promotes the HIF/VEGF axis in CLL B cells Vascular endothelial growth factor (VEGF) is highly expressed in B CLL cells (Ghosh et al, Blood 2009)

  36. Principles of miRNA-based gene therapy and in vivo inhibition of miRNA in cancer cells (Calin & Croce, J Clin Inv 2007)

  37. WHY SHOULD MIRNAS BE MORE EFFICIENT IN SPECIFICALLY KILLING MALIGNANT CELLS?

  38. miR-15 and miR-16 targeting multiple apoptosis- and cancer-related genes TRANSCRIPTOMA PROTEOMA (Calin, Cimmino & Fabbri et al, PNAS 2008)

  39. A B MEG01 MOCK MEG01 pRS-E MEG01 pR15/16 Mock pRS-E pRS15/16 1.8 1.6 1.4 1.2 1 Tumor Volume (mm3) 0.8 0.6 0.4 0.2 0 7 15 21 Days C Day 28 Tumor weight (grams) Mock pRS-E pRS15/16 miR-16 & miR-15 based Gene Therapy in CLL (Calin, Cimmino & Fabbri et al, PNAS, 2008)

  40. Two strategies for the use of RNA inhibition in human cancers • “sandwich RNA inhibition” - to focus with multiple different agents on a major molecular alteration clearly linked to the pathogenesis of a disease • * BCL2 overexpression in B cell malignancies - by using a combination of miR-15a, miR-16, ASO-BCL2. • “multiplex RNA inhibition targeting” - targeting various molecular defects in the multistep pathways of specific cancers • * The apoptotic pathway in CLL by using a miR-15a, miR-16, miR-29s targeting BCL2 and MCL1

  41. Mad spirit of cancer Ultraconserved genes megaRNAs proteins proteins miRNAs supressors miRNAs activators Opening Pandora’s box: Revisiting the molecular oncology dogma

  42. Carlo M. Croce Massimo Negrini Dragos T. Stefanescu Josephine Nefkens Institute Rotterdam Riccardo Fodde Ingrid De Vries Anieta Sieuwerts NIH Curtis Harris Stefan Ambs OSU-Pharmacology Tom Schmittgen Eun Joo Lee Johns Hopkins School of Medicine Curt Civin Rob Georgantas Calin’s laboratory Milena S. Nicoloso, MD Riccardo Spizzo, MD Masayoshi Shimizu, BS Simona Rossi, PhD Sang Kil Lee, MD Eun-Jung Jung, MD Jana Ferdin (Slovenia,) PhD std Maria Ines Almeida (Portugal), PhD std Juliana Edwards , PhD std Past or present students Elisa Barbarotto (Italy), Sumaiyah K. Rehman (India) Angelica Cortez (Brasil), Frederica Dimitri (Italy) David Rushwood, Manrique Guerrero, Julie Fogarty (US), Raul Terruel (Spain), Rosa Fabiola (Brasil) MDACC Anil Sood Bogdan Czerniak Chang-gong Liu Deepa Sampath Garth Powis Gordon Mills Guillermo-Garcia Manero Hagop Kantarjian Huaming Wang James Abbruzzese Jeff Bartholomeusz Jeffrey Myers Liana Adam Lynne Abbruzzo Marina Konopleva Michael Andreeff Michael Keating Ray DuBois Robert Bast Scott Kopetz Shuxing Zang Stanley Hamilton Varsha Gandhi Vinay Puduvali Yiling Lu Waldemar Priebe Wei Zhang William Plunkett Xiao-Feng Le Xiuping Liu Univ of Ferrara Massimo Negrini Manuela Ferracin CNIO, Madrid Manel Esteller Amaja Lujambio Univ of Genoa Silvio de Flora Alberto Izzotti Wistar Institute, Philly Ramana Davuluri Hao Sun TJU-KCC Philadelphia Cinzia Sevignani Terry Hyslop Linda Siracusa Fundeni Hospital, Romania Vlad Herlea Catalin Vasilescu microRNA FUNDINGS NIH-NCI & DOD & AACR MD Anderson Trust & Reagents Research Scholar CLL Global Research Foundation MicroRNAs and genomic dark matter alterations in human cancers

  43. It is very difficult…we could do…cfyyou… gvcjgyf…? Buywe?…hegruey…?! 534uiytfdu3…..12:1247 = fybrbc + fxnvhr …jhwhuerh….34@ = fshxbf LKM / KUHF…..23649 % 7(346) IWRE CIRE I am not sure that is going to work and it will take for ever?! How can we find targets? I am getting crazy to find them! Maybewe could ask in the microarray facility to customize microchips for miRNA genes! hsa-miR-143 ugagaugaagcacuguagcuca i Cinzia Sevignani 2005 Enjoy the ncRNA revolution!

More Related