1 / 53

Like Illumina, but immobilized templates are SS DNA molecules (~200 nt)

Last updated 11/03/10 1:00 AM. http://www.helicosbio.com/Technology/TrueSingleMoleculeSequencing/tabid/64/Default.aspx. Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group

hanae-sparks
Download Presentation

Like Illumina, but immobilized templates are SS DNA molecules (~200 nt)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Last updated 11/03/10 1:00 AM http://www.helicosbio.com/Technology/TrueSingleMoleculeSequencing/tabid/64/Default.aspx Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and washes it away. Several billion single molecule “spots” per slide.

  2. Helicos paired end sequencing 1 2 3 4 5 6 7

  3. Helicos virtual terminator Inhibits DNA Pol once incorporated (so 1 base at a time) Cleavable via the S-S bond (reduce it) Free 3’ OH never blocked dU-3’P,5’P dUTP

  4. Quantification of the yeast transcriptome by single-molecule sequencing Lipson et al. NATURE BIOTECHNOLOGY 27: 652, 2009 Tail 3’ end with A via terminal transferase, adding dT to terminate Make cDNA via oligo dT Add Cy5-labeled special nucleotide tri-Ps + DNA Pol. Wash. Record image. Hybridize to surface-linked oligo dTs Add next Cy5-labeled special nucleotide tri-Ps + DNA Pol. Wash. Record image. Cleave dye from incorporated nt. Wash.

  5. smsDGE = digital gene expression via Helicos sequencing and counting MA = microarray data

  6. QPCR (Quantitative PCR) Q-RT-PCR (Quantitative reverse transcription-PCR)

  7. Distribution of yeast transcripts mRNA Est. copies/cell: 0.5 5 50 500 TSS position relative to ATG TSS = transcription start site t.p.m. = transcripts per million

  8. http://www.pacificbiosciences.com

  9. ZMW = zero mode waveguide 10 zl volume seen (1 zeptoliter = 10-21 L.) Add template and special phospho nucleotides. One DNA Pol molecule per ZMW

  10. Cleaved when incorporated Other technologies Phospho-linked fluorescently-labeled nucleoside triphosphates

  11. Emission Excitation

  12. Use a circular template to get redundant reads and so more accuracy.

  13. Pacific Biosciences 3000 ZMWs, but density expected to climb Each ZMW capable of 400,000 bases per day 6 days X 3000 X 400,000 = 7.2 x 109 (at1X coverage) Predict by 2014 will sequence a human genome in 15 min.Predict by 2014 will sequence a human genome for low hundreds of $ Exact number of ZMWs per chip = “thousands,” perhaps 3000 as of 2010

  14. Applications of “deep” sequencing Also: definition and discovery of cis-acting regulatory motifs in DNA and RNA

  15. Detection of methylated C (~all in CpG dinucleotides) cytosine ----CmpG--- > ----CpG-- > ----CmpG--- > < ---G p Cm--- DS DNA Na bisulfite Heat Na bisulfite Heat ----CmpG--- > ----UpG-- > PCR ----TpG-- > ----CpG-- > <--GpC--- <--ApC--- All NON-methylated Cs changed to T uracil

  16. Definition and discovery of cis-acting regulatory motifs in DNA and RNA

  17. Definition of sequences (6-mers) that affect pre-mRNA splicing (Ke and Chasin, unpublished). Order an equal mixture of all 4 bases at these positions

  18. Rank 6-mer score (~ -1 to +1) 1 AGAAGA 1.0339 2 GAAGAT 0.9918 3 GACGTC 0.9836 4 GAAGAC 0.9642 5 TCGTCG 0.9517 6 TGAAGA 0.9434 7 CAAGAA 0.9219 8 CGTCGA 0.8853 :: 4086 TAGATA -0.8609 4087 AGGTAG -0.8713 4088 CGTCGC 0.8850 4089 CTTAAA -0.8786 4090 CCTTTA -0.8812 4091 GCAAGA 0.8911 4092 TAGTTA -0.8933 4093 TCGCCG 0.9113 4094 CCAGCA -0.8942 4093 CTAGTA -0.9251 4094 TAGTAG -0.9383 4095 TAGGTA -0.9965 4096 CTTTTA -1.0610 Best exonic splicing enhancers Worst exonic splicing enhancers, = best exonic splicing silencers

  19. Constitutive exons Alternativexons Pseudo exons Composite exon (from ~100,000)

  20. 23 Sequence of 36 Quality code CGCACTGTGCTGGAGCTCCCGGGGTTAACTCTAGAA abU^Vaa`a\aaa]aWaTNZ`aa`Q][TE[UaP_U] TACACTGTGCTGGAGCTCCCAACGGCAACTCTAGAA a`P^Wa`[`Wa^`X_X_XWVa^NSP]_]S^X_T\X^ CGCACTGTGCTGGAGCTCCCATGGAGAACTCTAGAA aTa`^b``baaaa^aab^YaTQLOHIa`^a``TX]] TACACTGTGCTGGAGCTCCCCTCCCAAACTCTAGAA I_`aaaa`aaaaaaa_a_^[KZIGIGZ`U`\^P^^` CGCACTGTGCTGGAGCTCCCAATAGTAACTTTAGAA aY_\abb[T\abaaa`a`bZ[HXXIZa_`_LGMS[` TATACTGTGCTGGAGCTCCCGACGTAAACTCTAGAA aba]^aa_a]`aa]_]`XWSMFGGIPX[P]X`V_Y^ TACACTGTGCTGGAGCTCCCTGGTAAAACTCTAGAA a_^a^aa`aYaaa_aY`Y_^[I]VY\`]V]R\W]VV TACACTGTGCTGGAGCTCCCAATAAAAACTCTAGAA XZababa`aZaaaaaYaYXX`baa``\\TaUa\aW` Variable region Constant regions (peculiar to our expt.) 2 nt barcode (TA or CG) Experiment: 1 1 1 2 2 1+2 2 2 1 2

  21. OUTLINE OF NEXT LECTURE TOPICSExpression and manipulation of transgenes in the laboratory 24 • In vitro mutagenesis to isolate variants of your protein/gene with desirable properties • Single base mutations • Deletions • Overlap extension PCR • Cassette mutagenesis • To study the protein: Express your transgene • Usually in E. coli, for speed, economy • Expression in eukaryotic hosts • Drive it with a promoter/enhancer • Purify it via a protein tag • Cleave it to get the pure protein • Explore protein-protein interaction • Co-immunoprecipitation (co-IP) from extracts • 2-hybrid formation • surface plasmon resonance • FRET (Fluorescence resonance energy transfer) • Complementation readout

  22. RS1 25 RS2 RS1 RS2 Site-directed mutagenesis by overlap extension PCR PCR fragment subsequent cloning in a plasmid Ligate into similarly cut vector 1 2 Cut with RE 1 and 2

  23. 26 Cassette mutagenesis = random mutagenesis but in a limited region: 1) by error-prone PCR Original sequence coding for, e.g., a transcripiton enhancer region ---------------------------------------------------------------------------------------------------------------------- PCR fragment with high Taqpolymerase and Mn+2 instead of Mg+2 errors ------*--------*--*-**---------------*-----------*--*-------*------------------------*-*-*------------*------------*-- Cut in primer sites and clone upstream of a reporter protein sequence. Pick colonies Analyze phenotypes Sequence

  24. 27 Cassette mutagenesis = random mutagenesis but in a limited region: 2) by “doped” synthesisTarget = e.g., an enhancer element ---------------------------------------------------------------------------------------------------------------------- Original enhancer sequence -*------------------------*-*-*------------*------------*-- ------*--------*--*-**---------------*-----------*--*------ Buy 2 doped oligos; anneal OK for up to ~80 nt. Clone upstream of a reporter. Doping = e.g., 90% G, 3.3% A, 3.3% C, 3.3% T at each position Pick colonies Analyze phenotypes Sequence

  25. Got this far

  26. 29 E. coli as a host • PROs:Easy, flexible, high tech, fast, cheap; but problems • CONs • Folding (can misfold) • Sorting -> can form inclusion bodies • Purification -- endotoxins • Modification -- not done (glycosylation, phosphorylation, etc. ) • Modifications: • Glycoproteins • Acylation: acetylation, myristoylation • Methylation (arg, lys) • Phosphorylation (ser, thr, tyr) • Sulfation (tyr) • Prenylation (farnesyl, geranylgeranyl on cys) • Vitamin C-Dependent Modifications (hydroxylation of proline and lysine) • Vitamin K-Dependent Modifications (gamma carboxylation of glu) • Selenoproteins (seleno-cys tRNA at UGA stop)

  27. 30 Some alternative hosts • Yeasts (Saccharomyces , Pichia) • Insect cells with baculovirus vectors • Mammalian cells in culture (later) • Whole organisms (mice, goats, corn) (not discussed) • In vitro (cell-free), for analysis only(good for radiolabeled proteins)

  28. 31 GAPDterm LEU2 GAPDprom Ampr oriE Yeast Expression Vector (example) Saccharomyces cerevisiae(baker’s yeast) 2 mu seq: yeast ori oriE = bacterial ori Ampr = bacterial selection LEU2, e.g. = Leu biosynthesisfor yeast selection 2 micron plasmid Complementation of an auxotrophy can be used instead of drug-resistance Your favorite gene(Yfg) Auxotrophy = state of a mutant in a biosynthetic pathway resulting in a requirement for a nutrient GAPD = the enzyme glyceraldehyde-3 phosphate dehydrogenase

  29. Vector DNA t p gfY Genomic DNA Genomic DNA HIS4 mutation- Yeast - genomic integration via homologous recombination HIS4 t p Yfg FunctionalHIS4 gene DefectiveHIS4 gene

  30. HIS4 Vector DNA AOX1t Yfg AOX1p 3’AOX1 Genomic DNA AOX1 gene (~ 30% of total protein) Genomic DNA Yfg 3’AOX1 AOX1p AOX1t HIS4 Double recombination Yeast (integration in Pichia pastoris) P. pastoris-tight control-methanol induced (AOX1)-large scale production (gram quantities) Alcohol oxidase gene

  31. PROTEIN-PROTEIN INTERACTIONS Yeast 2-hybrid system to discover proteins that interact with each other Or to test for interaction based on a hypothesis for a specific protein. (bait) ? Y = e.g., a candidate protein being tested for possible interaction with X Or: Y = e.g., a cDNA library used to discover a protein that interacts with X ? (prey) BD = (DNA) binding domain AD = activation domain http://www.mblab.gla.ac.uk/~maria/Y2H/Y2H.html

  32. No interaction between X and Y: no reporter expression Yes, interaction between X and Y: reporter protein is expressed: Y = e.g., a cDNA library used to discover a protein that interacts with X Recover the Y sequence from reporter+ colonies by PCR to idenify protein Y

  33. Fusion library Bait protein is the known target proteinfor whom partners are sought =“prey” and/or Two different assays help, as there are often many false positives. BD= DNA binding domain; TA = transactiavting domain http://www.mblab.gla.ac.uk/~maria/Y2H/Y2H.html

  34. 3-HYBRID: select for proteins domains that bind a particular RNA sequence Prey Bait Prey could be proteins from a cDNA library

  35. Yeast one-hybrid: Insert a DNA sequence upstream of the selectable or reporter Transform with candidate DNA-binding proteins (e.g., cDNA library) fused to an activator domain. Each T = one copy of a DNA target sequence

  36. Indirect selection using a yeast 3-hybrid system:a more efficient glycosynthase enzyme Directed Evolution of a Glycosynthase via Chemical Complementation Hening Lin,† Haiyan Tao, and Virginia W. Cornish J. AM. CHEM. SOC. 2004, 126, 15051-15059 Turning a glycosidase into a glyco-synthase Glycosidase: Glucose-Glucose (e.g., maltose) + H2O  2 Glucose

  37. Indirect selection using the yeast 3-hybrid system(one of the hybrid moelcules here is a small molecule) e.g., from a mutated library of enzyme glycosynthase genes glucose Leu2 gene Leu2 gene Transform a yeast leucine auxotroph. Provide synthetic chimeric substrate molecules. Select in leucine-free medium. DHFR = dihydrofolate reductase GR = glucocorticoid receptor (trancription factor ) MTX = methotrexate (enzyme inhibitor of DHFR) DEX = dexamethasone, a glucocorticoid agonist, binds to GR AD = activation domain, DBD = DNA binding domain

  38. Selection of improved cellulases via the yeast 2-hybrid system Survivors are enriched for cellulase genes that will cleave cellulose with greater efficiency (kcat / Km) Yeast cell Cellobiose (disaccharide) URA-3 (toxic) cellulase Directed Evolution of Cellulases via Chemical Complementation. P. Peralta-Yahya, B. T. Carter, H. Lin, H. Tao. V.W. Cornish. JACS 2008, 130, 17446–17452 x x x x Library of cellulase mutant genes (one per cell)

  39. Substrate

  40. URA-3 = gene for orotidine phosphate (OMP) decarboxylase Pathway to pyrimidine nucleotides: How does the URA-3 system work? analog 5-fluoroorotic acid 5-Fluoro-OMP URA-3 decarboxylation (pyr-4) 5-Fluoro-UMP Uridine kinase Exogenousuridine Thymidylate Synthetase inhibition RNA Death Ura3+ is FOA sensitive; ura3- is FOA resistant

  41. Measuring protein-protein interactions in vitro X=one protein Y= another protein Pull-downs: Binding between defined purified proteins, at least one being purified. Tag each protein differently. Examples: His6-X + HA-Y; Bind to nickel ion column, elute (his), Western with HA Ab GST-X + HA-Y; Bind to glutathione ion column, elute (glutathione), Western with HA Ab His6-X + 35S-Y (made in vitro); Bind Ni column, elute (his), gel + autoradiography. No antibody needed. (HA = influenza virus flu hemagglutinin) glutathione = Gamma-glutamyl-cysteinyl-glycine.

  42. Example of a result of a pull-down experiment Also identfy by MW (or mass spec) Total protein: no antibody or Western (stained with Coomassie blue or silver stain) Antibody used in Western Compare pulled down fraction (eluted)with loaded

  43. Western blotting To detect the antibody use a secondary antibody against the primary antibody. The secondary antibody is fusion protein with an enzyme activity (e.g., alkaline phosphatase). The enzyme activity is detected by its catalysis of a reaction producing a luminescent compound. http://www.bio.davidson.edu/courses/genomics/method/Westernblot.html

  44. Detection of antibody binding in western blots Antibody to protein on membrane Alkaline phosphatase fusion Non-luminescent substrate-PO4 = Y Y Luminescent product + PO4= Secondary antibody-enzyme fusion(e.g., goat anti-rabbit IgG) Detect by exposing to film Protein band on membrane

  45. Far western blotting to detect specific protein-protein interactions. Use a specific purified protein as a probe instead of the primary antibody To detect the protein probe use an antibody against it. Then a secondary antibody, a fusion protein with an enzyme activity. The enzyme activity is detected by its catalysis of a reaction producing a luminescent compound. protein protein http://www.bio.davidson.edu/courses/genomics/method/Westernblot.html

  46. Expression via in vitro transcription followed by in vitro translation T7 RNA polymerase binding site (17-21 nt) VECTOR cDNA ….ACCATGG….. Radioactively labeled protein 1. Transcription to mRNA via the T7 promoter + T7 polymerase 2. Add to translation system: rabbit reticulocyte lysate or wheat germ lysate Or: E. coli lysate (combined transcription + translation) All commerically available as kits Add ATP, GTP, tRNAs, amino acids, label(35S-met), May need to add RNase (Ca++-dependent) to remove endogenous mRNA In lysate NOTE: Protein is NOT at all pure (100s of lysate proteins present), just “radio-pure”

  47. A A A X X X X X X X X Y Y Y Y C Y D D B D C B C Y Y Y B A A A A A A A A A A A A A A A • Co-immunoprecipitation • Most times not true precipitation, which requires about equivalent concentrations of antigen and antibody • Use protein A immobilized on beads (e.g., agarose beads) • Protein A is from Staphylococcus aureus: binds tightly to Immunoglobulin G (IgG) from many species. Does X interact with Y in the cell or in vitro? incubate + + anti-X IgG Or cell extract + Protein A + Wash by centrifugation (or magnet) Elute with SDS Detect X, Y in eluate by Western blotting

More Related