1 / 48

Hillary Term 04: “The Human Genome”

Hillary Term 04: “The Human Genome”. 20.1 The Human Genome – evolutionary issues (Hein) 27.1 Non-Genic Selection in the Human Genome (Lunter) 3.2 Mammalian Genes I: Conservation and slow evolution (Ponting) 10.2 Mammalian Genes II: Functional innovation and rapid change (Ponting/Goodstadt)

hang
Download Presentation

Hillary Term 04: “The Human Genome”

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Hillary Term 04: “The Human Genome” 20.1 The Human Genome – evolutionary issues (Hein) 27.1 Non-Genic Selection in the Human Genome(Lunter) 3.2 Mammalian Genes I: Conservation and slow evolution (Ponting) 10.2 Mammalian Genes II: Functional innovation and rapid change (Ponting/Goodstadt) 17.2 RNAs in Human Genome (Sam Griffiths-Jones) 24.2 Population Genetics of the Human Genome (Gil McVean ) 2.3 Association Mapping and the Human Genome (Lon Cardon) 9.3 The Human Genome and Human Evolution (Chris Tyler-Smith)

  2. The Human Genome – key issues The Human Genome Project Few basic facts of the human genome Grammar of Genes Basic events happening to a genome per mitosis/generation Genealogical Structures: Phylogenies, Pedigrees and the ARG Long term Dynamics of the Human Genome: The comparative aspect (Genotype  Phenotype) & (Population Genetics/History) => Gene Mapping History Our interests.

  3. History of the Human Genome Project 1956 Physical map. 24 types and total set of 46 chromosomes 1977 Sanger publishes dideoxy sequencing method 1980 Botstein proposes human genetic map using RFLPs 1987 US DOE publishes report discussing HGP 1988 HUGO is established 1990 Official start of HGP with 3 billion $ and a 15 year horizon. 1991 Genome Database GB is established 1992 Genethon publishes map based on microsatelites. 1995 Lander et al. detailed map based on sequence tagged sites. 1998 Comprehensive map based on gene markers. 1999 Sanger Centre publishes chromosome 22 2001 Draft Genome published: Celera & Public 2003 Completion (almost) of Human Genome Strachan and Read, HMG3 p213

  4. Sequencing Strategies Celera - strategy: Public effort- strategy: From Myers 99 International Consortium’s view of Celera Celera’s view of International Consortium Unfair competition: Celera delivering the same goods but can use IC data, while IC cannot use Celera data. Unfair competition: IC delivering the same goods but with state funding.

  5. Other Genome Projects • 1976/79 First viral genome – MS2/fX174 • Mitochondrion • 1982 First shotgun sequenced genome – Bacteriophage lambda • First prokaryotic genome – H. influenzae • First unicellular eukaryotic genome – Yeast • 1998 The first multicellular eukaryotic genome – C.elegans • Drosophila melanogaster • 2000 Arabidopsis thaliana • 2001 Human Genome • Mouse Genome The Genome OnLine Database knows of 958 genome sequencing projects, of which 169 are completed

  6. Favourite and Model Organisms Multicellular Animals Mammals Human 3.5 Gb Mouse 3.2 Gb Cow 3.0 Gb Dog 2.8 Gb Rat 3.1 Gb Chimp 3.5 Gb Pig 3.0 Gb Fish Puffer Fish 0.4 Gb Zebra Fish 1.9 Gb Insects Drosophila 165 Mb Honey Bee 270 Mb Yellow Fever Mosquito 780 Mb Malaria Mosquito 278 Mb Birds Chicken 1.2 Gb Frog Xenopus Laevis 1.7 Gb Nematodes Caenorhabdites elegans 100 Mb Caenorhabdites briggsae 80 Mb Sea Urchin Strongylocentrotus purpuratus 800 Mb Multicellular Plants Arabidopsis thaliana125 Mb Rice 430 Mb Strachan and Read (2004) Chapter 8

  7. The Human Genome I http://www.sanger.ac.uk/HGP/ & R.Harding & HMG (2004) p 245 1 2 3 X 6 16 7 mitochondria 11 4 19 20 8 5 9 10 17 18 12 13 22 15 21 14 Y .016 45 66 72 48 51 104 3.2*109 bp 86 88 100 107 163 118 148 143 142 140 176 163 148 221 279 198 197 Myoglobin *5.000 a globin 251 b-globin (chromosome 11) 6*104 bp *20 Exon 3 Exon 1 Exon 2 3*103 bp 5’ flanking 3’ flanking *103 DNA: ATTGCCATGTCGATAATTGGACTATTTGGA 30 bp Protein: aa aa aa aa aa aa aa aa aa aa

  8. The Human Genome II http://www.sanger.ac.uk/HGP/ Nuclear Genome Mitochondria Highly conserved - coding 1.5% 93% Highly conserved - other 3.5% 5% Transposon based repeats 45 % - Heterochromatin 6.6% - Other non-conserved 44 % 2% Mendelian inheritance Maternal inheritance 1 (typically) Possibly thousands Recombination No recombination Gene Density: 1/130 kb 2 kb Pseudogenes: 20000 Processed Pseudogenes Strachan and Read (2004) Chapter 9

  9. The Human Genome III http://www.sanger.ac.uk/HGP/ Gene families Clustered a-globins (7), growth hormone (5), Class I HLA heavy chain (20),…. Dispersed Pyruvate dehydrogenase (2), Aldolase (5), PAX (>12),.. Clustered and Dispersed HOX (38 – 4), Histones (61 – 2), Olfactory receptors (>900 – 25),… Transposons Strachan and Read (2004) Chapter 9 + Lander et al.(2001)

  10. Genes and Gene Structures I • Presently estimated Gene Number: 24.000 (reference: ) • Average Gene Size: 27 kb • The largest gene: Dystrophin 2.4 Mb - 0.6% coding – 16 hours to transcribe. • The shortest gene: tRNATYR 100% coding • Largest exon: ApoB exon 26 is 7.6 kb Smallest: <10bp • Average exon number: 9 • Largest exon number: Titin 363 Smallest: 1 • Largest intron: WWOX intron 8 is 800 kb Smallest: 10s of bp • Largest polypeptide: Titin 38.138 smallest: tens – small hormones. • Intronless Genes: mitochondrial genes, many RNA genes, Interferons, Histones,.. Jobling, Hurles & Tyler-Smith (2004) HEG p 29 + HMG chapt. 9

  11. Genes and Gene Structures II Simple Eukaryotic Genes within Genes: Intron 26 of neurofibromatosis type I (NF1) contains 3 internal (2 exons) genes in the opposite direction. Overlapping Genes: Class III region of HLA Strachan and Read (2004) Chapter 9 p 258

  12. Alternative Splicing • A challenge to automated annotation. • How widespread is it? • Is it always functional? • How does it evolve? Cartegni,L. et al.(2002) “Listening to Silence and understanding nonsense: Exonic mutations that affect splicing” Nature Reviews Genetics 3.4.285- HMG p291-294

  13. RNAs in the Genome ~200 snoRNA small nucleolar, over 100 types - RNA modification and processing ~100 snRNA small nuclear - involved in splicing ~200 miRNA very small ~22bp , regulation ~175 28S,5.8S,5S large cytosolic subunit ~175 18S small mitochondrial subunit ~250 5S large mitochondrial subunit >500 tRNA transfer RNA >1500 Antisense RNA > 1500 types Strachan and Read (2004) p.247 F9.4

  14. Genome Annotation ESTs Proteins Genomes Ensembl http://www.ensembl.org Santa Cruz Genome Browser http://genome.ucsc.edu/

  15. Gene Finding and Protein (HMM) Descriptors Burge & Karlin jmb 96 Make gene characteristics to each nucleotide. Extract legal prediction by dynamical programming. B. Use HMM to describe biological knowledge of gene structure.

  16. Mutations and Mutation Rates 1 mitosis or generation Average Number of Mitoses Male generation (15:35 .. 20:150 Female generation: ~24 • Single nucleotide substitutions: ~10-7 • Microsatellites (~100.000): ~10-2 • Small insertion deletions: ~10-8 Crow,JF (2000) “The Origins, Patterns and Implications of Human Spontaneous Mutation” Nature Review Genetics 1.1.40-47 + Strachan and Read (2004) chapter 11 +Jobling, Hurles and Tyler-Smith (2004) chapter 2

  17. Recombination Recombination: Gene Conversion: 1 meiosis • Total Haploid length males: 25.9 M - females: 44.6 M. • Gene conversions 1-2 orders higher. Length 300-2000 pb. Lander et al.(2001) “Initial sequencing and analysis of the human genome” Nature 409.860-912. + Kong,E. et al.(2002) “A high resolution recombination map of the human genome” Nature Genetics

  18. Selection: Positive & Negative - - One sequence scenario Population scenario One sequence scenario again ThrSer ACGTCA A A A A C ThrPro ACGCCA C A ThrSer ACGCCG A A ArgSer AGGCCG A ThrSer ACTCTG A C C A AlaSer GCTCTG A A A A C AlaSer GCACTG C A The selection criteria could in principle be anything, but the selection against amino acid changes is without comparison the most important. Certain events have functional consequences and will be selected out. The strength and localization of this selection is of great interest.

  19. The Genetic Code Substitutions Number Percent Total in all codons 549 100 Synonymous 134 25 Nonsynonymous 415 75 Missense 392 71 Nonsense 23 4

  20. Examples of rates remade from Li,1997 Organism Gene Syno/year Non-Syno/Year RNA Virus Influenza A Hemagglutinin 13.1 10-3 3.6 10-3 Hepatitis C E 6.9 10-3 0.3 10-3 HIV 1 gag 2.8 10-3 1.7 10-3 DNA virus Hepatitis B P 4.6 10-5 1.5 10-5 Herpes Simplex Genome 3.5 10-8 Nuclear Genes Mammals c-mos 5.2 10-9 0.9 10-9 Mammals a-globin 3.9 10-9 0.6 10-9 Mammals histone 3 6.2 10-9 0.0

  21. Genealogical Structures ccagtcg Homology: The existence of a common ancestor (for instance for 2 sequences) ccggtcg cagtct Phylogeny Pedigree: Only finding common ancestors. Only one ancestor. Ancestral Recombination Graph – the ARG i. Finding common ancestors. ii. A sequence encounters Recombinations iii. A “point” ARG is a phylogeny

  22. Populations Grand parents Parents Now

  23. Genealogical approach to Population Variation Analysis Africa Non-Africa Inter.SNP Consortium (2001): A map of human genome sequence variation containing 1.42 million SNPs. Nature 409.928-33

  24. Total Pedigree Pedigrees Burke’s British Peerage http://www.burkes-peerage.net/sites/wars/sitepages/home.asp Chinese http://demography.anu.edu.au/People/Staff/zhongwei.html Quebec French Heyer and Tremblay, 1998 PNAS Mormons http://genealogy-mormons.com/ Icelandic http://www.decode.com + Helgason, A. et al. (2003 June) “A population-wide coalescent analysis of Icelandic matrilineal and patrilineal genealogies: Evidence for a faster evolutionary rate of mtDNA lineages than Y-chromosomes” American Journal Human Genetics. Helgason

  25. Genealogical Questions Pedigrees Time back to first individual common ancestor to everyone ARG questions: The height of ARGs - correlation between local phylogenies Gene Phylogeny Questions Total Branch Length - Height

  26. Long Term Evolutionary History: Myr/Gyr Origin of Life Last Universal Common Ancestor – LUCA First Eukaryotes First Chordates First Vertebrates First Mammals First Primates First Hominoids Chimp-Human Split Hedges, SB (2002) “The Origin and Evolution of Model Organisms” Nature Review Genetics 3.11.838-848. Brown (2003) “Horizontal Genetic Transfers “ Nature Genetics

  27. The Comparative Aspect. MRCA-Most Recent Common Ancestor ? Time Direction Parameters:time rates, selection UnobservableEvolutionary Path ATTGCGTATATAT….CAG ATTGCGTATATAT….CAG ATTGCGTATATAT….CAG 3 Problems: i. Test all possible relationships. ii. Examine unknown internal states. iii. Explore unknown paths between states at nodes. observable observable observable

  28. C C A A G C A U U One Principle of Comparative Genomics Observable Unobservable Protein Structure Goldman, Thorne & Jones, 96 RNA Structure Gene Structure Observable Unobservable

  29. Molecular Evolution and Gene Finding:Two HMMs AGTGGTACCATTTAATGCG..... Pcoding{ATG-->GTG} or AGTGGTACTATTTAGTGCG..... Pnon-coding{ATG-->GTG} Simple Prokaryotic Simple Eukaryotic

  30. The Rise of Comparative Genomics Lander et al(2001) Figure 25A

  31. The Domain of Comparative Genomics Cabbage 6 1 3 4 7 8 2 5 4 Turnip RNA (Secondary) Structure Gene Order/Orientation. Protein Structure 8 6 2 3 5 1 7 ACTGT Renin ACTCCT HIV proteinase Sequences General Theme. Formal Model of Structure Stochastic Model of Structure Evolution. Interaction Networks Any Graph. Gene Structure

  32. D r M Linkage Mapping From McVean

  33. Association/Fine scale mapping 2Ne generations Dominant/Recessive. Penetrance Spurious Occurrence Heterogeneity A set of characters. Binary decision (0,1). Quantitative Character. genotype phenotype Genotype  Phenotype

  34. BRCA2 example 1000 cases and 1000 controls typed at 8 microsatellite markers Single marker association Bayesian analysis Causative SNPs. Rafnar et al.(2004) – Morris et al(2001) +

  35. Short Term Evolutionary History: Kyr/Myr Supposedly well behaved populations Iceland Finland Sardinia Oldest Polymorphisms Neutral Human Autosomal Polymorphisms First Out-of-Africa Anatomically Modern Man Peopling of the Globe – genetic and fossil evidence. The globe & migrations: Cavalli-Sforza,2001 + HEG (2004)

  36. HapMap Started October 27-29, 2002 “The International HapMap Project “Nature426, 789 - 796 (18 Dec 2003) http://www.hapmap.org/

  37. HapMap

  38. Ontologies A Structured Vocabulary – Consistent across species. Purpose: Facility communication among researchers Facility communication among computer systems 2001: Three Ontologies: Molecular Function Biological Process Cellular Component Source NAR(2004) 32.D258- http://www.geneontology.org Gene Ontology Consortium (2001) “Creating the Gene Ontology Resource: Design and Implementation.” Genome Research 11.1425-33 Gene Ontology Consortium (2004) “The Gene Ontology (GO) database and informatics resource” Nucleic Acid Research 32.D258-61.

  39. Structural Genomics: Systematic Structure Determination • Examples: • Center for Eukaryotic Structural Genomics • Structural Genomics of Pathogenic Protozoa Consortium • Berkeley Structural Genomics Center : Mycoplasma genitalium and Mycoplasma pneumoniae PDB Holdings List: 10-Feb-2004 http://www.strgen.org/http://www.nysgrc.org/ http://www.oppf.ox.ac.uk/ http://pdb.ccdc.cam.ac.uk/pdb/strucgen.html John Westbrook, Zukang Feng, Li Chen, Huanwang Yang and Helen M. Berman “The Protein Data Bank and structural genomics” Nucleic Acids Research, 2003, Vol. 31, No. 1 489-491

  40. Structural Genomics: Mycoplasma pneumoniae proteins http://www.strgen.org/status/mpoverview.html

  41. Source: Hanash (2003) Proteomics 2D PAGE gels (polyacryl gel electrophoresis ) MALDI Protein Micro-arrays Source Gavin et al.(2002) http://www.hupo.org Hanash,S.(2003) “Disease Proteomics” Nature 422.226- Aebersold,R. and M.Mann (2003) “Mass spectrometry-based proteomics” Nature 422.198- Gavin et al. (2002) “Functional Organisation of the Yeast Proteome by systematic analysis of protein complexes” Nature 415.141-

  42. Summary The Genome Genomes: Variation and long term evolution. Genealogical Structures: Phylogenies, Pedigrees and the ARG Long term Dynamics of the Human Genome: The comparative aspect (Genotype  Phenotype) & (Population Genetics/History) => Gene Mapping

  43. Our Genomically Motivated Projects • Comparative gene annotation (Meyer, Skou Pedersen) • Superimposed selective constraints (Forsberg, Meyer, Skou Pedersen) * • Haplotype Blocks (Song) * • Genome transformations (Miklos) • Ancestral Blocks* • Statistical Sequence Comparison (Drummond, Lunter, Miklos) • Substitutions and insertion-deletions at the Genome Level (Lunter) Next week

  44. Minimal ARGs and Haplotype Blocks (Song) a: (3,4) b: (3,4) c: (15,16) d: (16,17) e: (35,36) f: (35,36) g: (36,37)

  45. Combining Levels of Selection. Forsberg, Meyer, Pedersen Assume multiplicativity: fA,B = fA*fB Protein-Protein Hein & Støvlbæk, 1995 Codon Nucleotide Independence Heuristic Jensen & Pedersen, 2001 Contagious Dependence Protein-RNA Singlet Doublets Contagious Dependence

  46. Applications to Human Genome (Wiuf and Hein,97) 0 260 Mb 0 52.000 *35 0 7.5 Mb 6890 8360 *250 30kb 0 Parameters used 4Ne 20.000 Chromos. 1: 263 Mb. 263 cM Chromosome 1: Segments 52.000 Ancestors 6.800 All chromosomes Ancestors 86.000 Physical Population. 1.3-5.0 Mill. A randomly picked ancestor: (ancestral material comes in batteries!)

  47. References: Books & www-pages. Books: Strachan and Read (2004) “Human Molecular Genetics” (3rd Ed.) Bioscience Jobling, Hurles and Tyler-Smith (2004) “Human Evolutionary Genetics” Bioscience Sulston, J.(2002) “Our Common Thread” Corgi Books Ridley, Matt (2001) “Genome” “Encyclopedia of the Human Genome” (2003) Nature Publishing Group Cavalli-Sforza,L. (2001) “Genes, People and Language” Penguin Key articles: Lander et al.(2001) “Initial Sequencing and Analysis of the Human Genome” Nature Venter et al.(2001)”The Sequence of the Human Genome” Science 291.1304-1351

  48. References: www-pages. Major sequencing centers: Baylor College of Medicine Genome Sequencing Center hgsc.bcm.tcm.edu/ Celera www.celera.com DoE Joint Genome Institute www.jgi.doe.gov Genoscope www.genoscope.cns.fr TIGR www.tigr.org Washington University Genome Sequencing Center www.genome.wustl.edu Wellcome Trust Sanger Institute www.sanger.ac.uk Whitehead Institute/MIT Center for Genome Research www.-genome.wi.mit.edu Ensembl genome annotator - www.ensembl.org European Bionformatics Institute - www.ebi.ac.uk NCBI - www.ncbi.nlm.nih.gov Nature Genome Gateway http://www.nature.com/genomics/human/ Integrated Genomics http://wit.integratedgenomics.com/GOLD/ Ebi genome databases http://www2.ebi.ac.uk/genomes/ Primate Sequencing Projects http://sayer.lab.nig.jp/~silver/index.html European Bioinformatics Institute Proteomics http://www.ebi.ac.uk/proteome/ National Center for Biotechnology Information http://www.ncbi.nlm.nih.gov/ HapMap Project Homepage http://www.hapmap.org/ Online Inheritance in Man http://www.ncbi.nlm.nih.gov/omim/

More Related