1 / 20

This video is licensed under a Creative Commons Attribution-Share Alike 3.0 Unported license.

Useful Genetics Professor Rosie Redfield The University of British Columbia. This video is licensed under a Creative Commons Attribution-Share Alike 3.0 Unported license. Lecture 1G. Homology and variation. ??. Outline:. Homology How DNA sequences are compared

havyn
Download Presentation

This video is licensed under a Creative Commons Attribution-Share Alike 3.0 Unported license.

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Useful Genetics Professor Rosie Redfield The University of British Columbia This video is licensed under a Creative Commons Attribution-Share Alike 3.0 Unported license.

  2. Lecture 1G • Homology and variation ?? Outline: Homology How DNA sequences are compared Alleles, variants, SNPs, indels c) Genetic variation reflects evolutionary history Learning objectives: • Recognize and interpret evolutionary relationships of sequences and traits • Describe genetic variation in populations This video is licensed under the Creative Commons Attribution-Share Alike 3.0 Unported license.

  3. “Nothing in biology makes sense except in the light of evolution.” Theodosius Dobzhansky 1973

  4. Homology: Similarity due to shared ancestry. human dog bird whale Homologous limb bones in vertebrate species Image by Petter Bockmann, from Wikimedia Commons

  5. Homology: Similarity due to shared ancestry. Homologous genes in fruit flies and mice (and humans) The genes have similar sequences, functions, and order on the chromosome.

  6. Homology: Similarity due to shared ancestry. Homologous gene sequences in fruit flies and humans Gene: Amino acid sequence (single-letter abbreviations): Aniridia (Human) eyeless (Fruit fly)

  7. Homology: Similarity due to shared ancestry. The possible causes of similarity 1. chance 2. selection for the same function (convergent evolution) 3. common ancestry (homology)

  8. Homology: Similarity due to shared ancestry. The logic of inferring homology If similarities are: 1. too strong to have arisen by chance, and 2. too arbitrary to have arisen by convergent evolution, we infer they must exist due to divergence from a common ancestor.

  9. Question: Which of these pairs are homologous? A mouse and a computer mouse The tail of a mouse and the tail of a rat Your chromosome 7 and your chromosome 17 A mouth and a microphone Your eye and a fish’s eye

  10. Question: Which of these pairs are homologous? A mouse and a computer mouse The tail of a mouse and the tail of a rat Your chromosome 7 and your chromosome 17 A mouth and a microphone Your eye and a fish’s eye

  11. Homology: Similarity due to shared ancestry. The logic of using homology to infer relationships Once we’ve decided that DNA or protein sequences are homologous, their degree of similarity tells us how recent their common ancestor was. seq. 1 • ...gaccactgcccgaggtaccgaagcacttggtactgtatggtaca... • ...||||||||||||||||| ||||||||||||| ||||||||||||... seq. 2 • ...gaccactgcccgaggtagcgaagcacttggttctgtatggtaca... • ...|| || ||||| ||||| |||||| ||| ||||||| ||||||... seq. 3 • ...gatcaatgccctaggtacggaagcatttgcttctgtacggtaca...

  12. Comparing two DNA sequences (alignment matters!): • .....gaccactgcccgagaggaagggttctggg... Seq#1 |||||||||||||| |||||||||||||| | || | | | || | || | | | | | | | • ...gaccactgcccgaggggaagggttctgggtaca... Seq#2 The vertical lines indicate positions that have the same base.

  13. Thinking about DNA sequence differences Alleles: Non-identical versions or variants of a gene or, more generally, of a DNA sequence. A single-nucleotide variant; the presence of different nucleotides at homologous positions in two DNA sequences. SNVs: gaccattgcccgagaggaagggttccggg gaccattgcccgaggggaagggttccggg Example: Genome 1: Genome 2: A genetic difference created by insertion or deletion of a bp or a longer DNA segment. Indel: * Example: Genome 1: Genome 2: • ggatacagttccgggagaccattgccacgag • ggatacagtagaccattgccacgag

  14. ....:....:....:....:....:....: Haplotype: The genotype of a short segment of a chromosome 10 20 30 Example: Genome 1: Genome 2: ataccattgcccgagaggatgggttcccgg agaccattgcccgaggggaagggttccggg

  15. Homology: Similarity due to shared ancestry. A special usage in genetics: Chromosomes that carry different versions of the same information are called ‘homologous chromosomes’. Chromosome 7 from Mom The same genes are on each, in the same order. The DNA sequences differ by only ~0.1% Chromosome 7 from Dad The sequences are so similar because they share very recent ancestry (sexual reproduction).

  16. Question: How many different alleles of a gene can one person have? 1 2 23 46 It depends how big the gene is

  17. Genetic variation in populations Rare variant: A genetic difference present in <1% of the population. A single-nucleotide polymorphism; a SNV present in ≥1% of the population. SNP (‘snip’): Polymorphism: A genetic difference present in ≥1% of the population. agaccattgcccgagaggaagggttccggg agaccattgcccgaggggaagggttccggg Example:

  18. Genetic variation in populations Rare variant: A genetic difference present in <1% of the population. A single-nucleotide polymorphism; a SNV present in ≥1% of the population. SNP (‘snip’): Polymorphism: A genetic difference present in ≥1% of the population. agaccattgcccgagaggaagggttccggg agaccattgcccgaggggaagggttccggg Example:

  19. What we’ve done Homology Comparing DNA sequences – alignment matters Genetic variation in populations New terms: homology, homologous chromosome, polymorphism, SNP, indel, haplotype

  20. Coming up.... ? 98 Lecture 1H • Human evolutionary history Genetic variation in Europeans 73 199 Genetic variation in Africans Genetic variation in Asians

More Related