CHAPTER 17 FROM GENE TO PROTEIN

1. DNA makes ______ makes __________. Proteins are the links between ________ and_________. CHAPTER 17 FROM GENE TO PROTEIN • In 1909- Archibald _______ suggested that 1. genes dictate phenotype through enzymes that catalyze specific chemical reactions in the cell. 2. the symptoms of an inherited disease reflect a person’s inability to synthesize a particular ___________. • Gerrod speculated that alkaptonuria, a hereditary disease, was caused by the absence of an enzyme in a pathway

2. The idea of __________ pathways was suggested 1930s- George Beadle and Boris Ephrussi speculated that each mutation affecting ________ in Drosophila blocks pigment synthesis at a specific step by preventing production of the ___________ that catalyzes that step. 1. The study of metabolic defects provided evidence that genes specify proteins Actual evidence for metabolic pathways came from Beadle and Tatum in the 1930s

3. Organism used- -bread mold, Neurospora crassa. Beadle and Tatum Experiment Experiment • 1. Mutate Neurospora with __________ • 2. Screened the survivors for mutants that differed in their nutritional needs. • ____________ Neurospora can grow on a ____________ medium • Minimal medium = agar, inorganic salts, glucose, and the • vitamin biotin. • Most nutritional mutantscan survive on a complete growth medium which includes all 20 amino acids. 3. If mutant failed to grow on minimal medium, add amino acid ____________ until growth is evident Results 1. Identify a number of mutants that did not grow on arginine, but would grow if supply arginine pathways intermediates

4. Their results provided strong evidence for the onegene - one __________ hypothesis. Later modified to the one gene-one __________ hypothesis Why? Not all proteins are _____________ Gene A Gene B Gene C Gene A mutants Gene B mutants Gene C mutants Fig. 17.2

5. The bridge between DNA and __________synthesis is RNA. RNA differs from DNA 1. RNA contains ________ as its sugar (not deoxyribose) 2. _________ replaces thymine. AGTCAT becomes AGUCAU 3. An RNA molecule almost always consists of a ________ strand. This is an H in DNA 2. Transcription and translation are the two main processes linking gene to protein

6. In DNA or RNA, only four nucleotides produce life The specific _________ of hundreds or thousands of nucleotides in each gene carries the information for the primary structure of a protein, the linear order of the ____ possible amino acids. To get from DNA, written in one chemical language, to protein, written in another, requires two major stages, ____________ and____________ .

7. ____________ - DNA is the template for RNA, usually __________ RNA (mRNA). • ____________________ - the information contained in the order of nucleotides in mRNA is used to determine the __________ sequence of a polypeptide. • -Translation occurs at ____________. Fig. 17.3a • The basic mechanics of transcription and translation are ________ in eukaryotes and prokaryotes.

8. 2. Eukaryotes- Before the ________ can leave the nucleus it is modified in various ways during __________________ before the finished mRNA is exported to the cytoplasm. Major differences between prokaryotes and eukaryotes- • Transcription and translation are __________in bacteria (which lack________ ), but occur at separate locations in eukaryotes. • - In bacteria, ___________attach to the leading end of a mRNA molecule while transcription is still in progress. • -In a eukaryotic cells, almost all transcription occurs in the nucleus and translation occurs mainly at ribosomes in the cytoplasm. Protein RNA DNA Fig. 17.3b

9. A single or doublet code can not provide enough ____________ (4 and 16 respectively) to code for all 20 amino acids. Triplets of nucleotide bases are the smallest units of uniform length that can code for all the amino acids. In the__________, three consecutive bases specify an amino acid, creating 43 (64) possible__________. The genetic instructions for a polypeptide chain are written in DNA as a series of three-_________ words. 3. In the genetic code, nucleotide triplets specify amino acids

10. During transcription, one DNA strand, the_____________, provides a template for ordering the sequence of nucleotides in an RNA transcript. The _____________RNA molecule is synthesized according to base-pairing rules, except that _______ is the complementary base to adenine. During translation, blocks of three nucleotides, _______, are decoded into a sequence of amino acids. Template strand mRNA Protein Fig. 17.4

11. During translation _________ are read in the 5’->3’ direction Each codon specifies _____ of the 20 amino acids It is a triplet code: three bases for one amino acid It would take at least ____ nucleotides to code for a polypeptide that is 100 amino acids long. Problem: We have 64 possible combinations of the nucleotides Why 64 possibilities? How many ways can you arrange 4 bases in sets of three? Answer = _____ =________________ Thus, predict that _______________ combination must specify a given amino acid

12. 1960s-Marshall Nirenberg determined the first match, that UUU coded for the amino acid _______________. Experiment - Add poly-U (uracil-only) RNA _______ plus amino acids, ribosomes, other components. Result- This poly(U translated into a long chain of phenyalanine. Other more elaborate techniques were required to decode mixed triplets such a AUA and CGA. By the mid-1960s the entire code was _________________. PhePhePhePhe UUUUUUUUUUUUUUU

13. 1. ___ of 64 triplets code for amino acids. AUG codes for the methionine and_______of translation. The genetic code Know how to read this chart!! • Three codons –UAA, UAG and ______ do not code amino acids but signal the termination of translation. 2. The genetic code is ___________ but not______________ . • Typically several different codons specify a given amino acid • Any one codon indicates ___________ amino acid. Fig. 17.5 • If you know a specific codon, you know the amino acid • If you know only the amino acid, there may be several possible codons • Example- Both GAA and GAG specify glutamate, but no other amino acid.

14. The genetic code (cont.) Fig. 17.5 • Codons synonymous for the same amino acid often differ only in the _______ codon position. Example: GUU, GUC, GUA and GUG all encode ________ A ________________ is established at the translation start 3’ RNA 5’ UUACGAUGGAUUCAAACGUCAGGGCCUAAGGCUAG Met Asp Ser Asn Val Arg Ala Stop codon Start codon Summary- The genetic code uses__________________________, or codons, each of which is translated into a specific amino acid.

15. The genetic code is nearly__________ , from bacteria to mammals Thus, we can synthesize bacterial proteins in_________ • Exceptions do exist- they use slightly altered genetic codes: • 1.single-celled eukaryotes like • Paramecium. 2. certain mitochondria and chloroplast_______

16. Transcriptioncan beseparatedinto threestages:1. _________2. elongation 3. __________ 4. Transcription is the DNA-directed synthesis of RNA Fig. 17.7

17. Messenger RNA is transcribed from the template strand of a gene by _____________________. ___________________: separates the DNA strands bonds the RNA nucleotides as they base-pair along the DNA template. can add nucleotides ______ to the ________ of the growing polymer. Genes are read _______ creating a ______RNA molecule. What actually makes the RNA? RNA 5’ 3’ DNA 3’ 5’

18. Bacteria -________ type of RNA polymerase that synthesizes all RNA molecules. Eukaryotes -_________ RNA polymerases (I, II, and III) in their _________ . ___________________ is used for ________synthesis. Compare prok and euk polymerases What marks the start of transcription?? • Answer- Specific sequences of nucleotides called the _________ mark where gene transcription begins • In prokaryotes, RNA polymerase can recognize and bind __________ to the promotor region. • In eukaryotes, proteins called ________________ first bind the promotor region, especially a_________ , then RNA polymerase II binds

19. Eukaryotes- The complex including RNA polymerase II plus transcription factors is called the _________________. 1. Initiation Fig. 17.8

20. As RNA polymerase ________ the double helix,10 to 20 bases at time. The enzyme addsnucleotides to the___ end of thegrowing strand. Behind the pointof RNA synthesis,the double helix_______ and theRNA moleculepeels away. 2. Elongation Fig. 17.7

21. A single gene can be transcribed simultaneously by _____________ RNA polymerases at a time. A growing strand of RNA trails off from each______________. 2. Elongation (cont.) RNA 5’ 5’ DNA 3’ TATAA 5’

22. Prokaryotes- RNA polymerase stops transcription at the end of the______________ . Both the RNA and DNA is then released. ______________- the polymerase continues for hundreds of nucleotides past the terminator sequence,_____________ . At a point about _____________ nucleotides past this sequence, the pre-mRNA is cut. 3. Termination 5’ 5’ 3’ AAUAAA TATAA 10-35 nucleotides

23. Modifications include: 1. A ________at the 5’ end of the pre-mRNA molecule The cap is a modified form of guanine Function: a. Protect mRNA from __________enzymes. b. “Attach here” signal for____________ 5. Eukaryotic cells modify RNA after transcription • 2. _____________50 to 250 adenine nucleotides at the 3’ end • Function- a. inhibiting hydrolysis, b. facilitating ribosome ___________c. facilitate the export of mRNA from the nucleus. 3’ tail 5’ cap Fig. 17.9 • The mRNA molecule also includes ____________leader and trailer segments.

24. 3. ______________ - Most eukaryotic genes and their RNA transcripts have long ____________ stretches of nucleotides. The noncoding segments are called ________ The coding regions (final mRNA transcript) are called__________ RNA modification in eukaryotes (cont.) • What is a coding region?? • RNA sequences that are translated into amino acid sequences Leader Coding region Trailer 3’ tail 5’ cap Fig. 17.9

25. Fig. 17.10 • RNA splicing removes ______ and joins ______ to create an mRNA molecule with a _____________ coding sequence.

26. This splicing is accomplished by a________________. • Contains small nuclear ribonucleoproteins (snRNPs). and small nuclear RNA molecules (snRNA). Each is about 150 nucleotides long. Fig. 17.11 Splicing steps (1) Pre-mRNA combines with _________ and other proteins to form a spliceosome. (2) Within the spliceosome, ________ base-pairs with nucleotides at the ends of the intron. (3) The RNA transcript is cut to release the________ , and the exons are spliced together; Here the snRNA acts as a____________ , an RNA molecule that functions as an enzyme.

27. Overview of eukaryotic transcription/translation Chromosome- 1.5 x 108 base pairs containing about 3000 genes 5’ 3’ 5’ 3’ 0.4% of a chromosome, containing 10 genes UAA UAA = exon = intron F B C D E TAA ATG DNA +1 Template strand Transcription AAUAAA AUG hnRNA Promoter RNA Splicing polyA tail,cap Transport to cytoplasm E A B C D F 7mG mRNA AAAAAA….. AUG Translation Protein COO- NH2 Poly-A tail Cap

28. ______________(tRNA) - transfers amino acids from the cytoplasm’s pool to a ______________ . The ribosome adds each amino acid carried by tRNA to the growing end of the ______________ chain. 6. Translation is the RNA-directed synthesis of a polypeptide How do proteins read the RNA molecule?? Answer-the tRNA molecule Fig. 17.13

29. A tRNA molecule Is about ___ nucleotideslong Contains attachment site at the 3’ end for an amino acid. Contains a loop with the ___________ Fig. 17.14 3’ 5’ The anticodon base-pairs with a complementary codon on mRNA. • If the codon on mRNA is UUU, a tRNA with a • ______ anticodon and a tRNA carrying phenylalanine will bind to it. • The anticodons of some tRNAs recognize more than one________. • Why? Because the rules for base pairing between the third base of the codon and anticodon are ________ (called______________).

30. If each anticodon had to be a perfect match to each codon, we would expect to find ___ types of tRNA, but the actual number is about____ . At the wobble position, U on the _____________can bind with A or G in the third position of a codon. Some tRNA anticodons include a modified form of adenine, inosine, which can hydrogen bond with U, C, or A on the codon. How do we explain this “wobble”??

31. “Wobble” base pairing Fig. 17.5 Leu “Wobble” AAU AAU UGGCGAUGUUAGUAUUGCAUGAGUUAGGUGACCAAGAU Start Leu Leu

32. Each amino acid is joined to the correct tRNA by ____________________________The 20 different synthetases match the 20 different________________. The synthetase catalyzes a covalent bond between them, forming _______________ or activated amino acid. How the is the tRNA linked to the amino acid?? Fig. 17.15 • ______________ (protein + rRNA) facilitate the specific coupling of the tRNA anticodons with mRNA codons. phetRNA Protein Ribosomal subunits 1. Large RNA 2. Small

33. Each ribosome has a binding site for mRNA and three binding sites for tRNA molecules. The ________ holds the tRNA carrying the growing polypeptide chain. The ______carries the tRNA with the next__________. Discharged tRNAs leave the ribosome at the_________. Fig. 17.16

34. Translation can be divided into three _________ : 1. initiation 2. ____________ 3. termination Both initiation and chain elongation require energy provided by the hydrolysis of________. Translation 1. Initiation • Small ribosomal subunit binds mRNA • Initiator tRNA (with methionine) is attached to start codon • Initiation factors bring in the large subunit such that the initiator tRNA occupies the P site. Fig. 17.17

35. Translation 2. Elongation - ________ steps per amino acid added a. Codon recognition- an elongation factor assists hydrogen bonding between the mRNA codon under the A site with the corresponding anticodon of tRNA carrying the appropriate amino acid. • This step requires the ____________ of two GTP. b. _____________________- a ________ molecule catalyzes the formation of a peptide bond between the polypeptide in the P site with the new amino acid in the A site c. ____________ - the ribosome moves the tRNA with the attached polypeptide from the A site to the P site. Fig. 17.18 Note: mRNA is “read” 5’ -> 3’, codon by codon.

36. 3. Termination occurs when one of the three ______ codons reaches the ___ site. A ____________ binds to the stop codon and hydrolyzes the bond between the polypeptide and its tRNA in the P site. Translation Fig. 17.19 Other translation facts • Multiple ribosomes, polyribosomes, may trail along the same mRNA. • A ribosome requires less than a minute to translate an average-sized mRNA into a polypeptide. Fig. 17.20

37. Additions of________ , lipids, or phosphate groups to amino acids. Enzymes may remove some amino acids or cleave whole polypeptide chains. Two or more ______________ may join to form a protein. Post-translational modifications-

38. Recall that some ribosomes reside in two locations- Free ribosomes are suspended in the ________ and synthesize proteins that reside in the__________ . __________ ribosomes are attached to the cytosolic side of the_______________________. They synthesize proteins of the endomembrane system as well as proteins secreted from the cell. 7. Signal peptides target some eukaryotic polypeptides to specific destinations in the cell

39. Translation in all ribosomes begins in the cytosol A polypeptide destined for the ________________ system or for export has a specific ________________ (approx 20 amino acids) region at or near the leading end. A _________________________(SRP) binds to the signal peptide and attaches it and its ribosome to a receptor protein in the ER membrane. The SRP leaves and protein synthesis resumes with the growing polypeptide snaking across the membrane into the cisternal space Fig. 17.21

40. RNA is versatile ________ - carries info for protein production _______-transport amino acids in translation _______- part of ribosome, has role in translation ________ - splicing mRNA 8. RNA plays multiple roles in the cell: a review

41. 9. Comparing protein synthesis in prokaryotes and eukaryotes: a review Euks Proks DNA polymerase Requires Transcription and translation coupled? RNA processing? Protein targeting?

42. 10. Point mutations can affect protein structure and function • __________ are changes in the genetic material of a cell (or virus). • include large-scale mutations in which ______ segments of DNA are affected (translocations, duplications, and inversions). • A chemical change in just one base pair of a gene causes a_______________ Fig. 17.23 In sickle cell, a single T to A mutation changes amino acid from glu to val • ______________________ - alterations of nucleotides still indicate the same amino acids because of redundancy in the genetic code. • Many other mutations cause no effect in function

43. Other base-pair substitutions cause a readily detectable change in a protein. ____________mutations are those that still code for an amino acid but change the indicated amino acid. ____________mutations change an amino acid codon into a _____ codon, nearly always leading to a nonfunctional protein. Fig. 17.24

44. Insertions and ____________ are additions or losses of nucleotide pairs in a gene. These have a __________ effect on the resulting protein more often than substitutions do. Unless these mutations occur in multiples of three, they cause a ___________ mutation. All the nucleotides downstream of the deletion or insertion will be improperly grouped into codons. The result will be extensive missense, ending sooner or later in nonsense - premature termination. Fig. 17.24

45. ______________ are chemical or physical agents that interact with DNA to cause mutations. ___________ agents include high-energy radiation like X-rays and ultraviolet light. _________ mutagens may operate in several ways. As base ________ ___that may be substituted into DNA, but that pair incorrectly during DNA replication. Interfere with DNA replication by inserting into DNA and distorting the____________________. Cause chemical changes in bases that change their pairing properties.

46. ___________ concept - a discrete unit of inheritance that affects phenotype. Morgan and his colleagues assigned genes to specific loci on chromosomes. A specific nucleotide sequence along a region of a DNA molecule. A DNA sequence that codes for a specific polypeptide chain. Aregion of DNA whose final product is either a polypeptide or an RNA molecule. 11. What is a gene? revisiting the question or or or

47. Fig. 17.26