1 / 29

Understanding Gene to Protein Process: Transcription & Translation

Learn about Beadle and Tatum's gene research, transcription, translation, RNA processing, and the ribosome structure involved in protein synthesis. From gene mutations to amino acid sequences, explore the journey of genetic information to functional proteins.

mcferren
Download Presentation

Understanding Gene to Protein Process: Transcription & Translation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Chapter 17 – From Gene to Protein

  2. One Gene – One Enzyme • Beadle and Tatum (1930s) • Bombarded Neurospora (bread mold) with radiation to create mutants that could grow on different types of nutritional medium • Created 3 classes of mutants which grew with different media • Deduced each mutant was unable to carry out one step of the arginine pathway • Revised theory to One Gene – One Polypeptide (many enzymes are made up of multiple polypeptide chains.

  3. Protein Synthesis: Overview • Transcription: • Synthesis of RNA under the direction of DNA (mRNA) • Occurs in the nucleus (of eukaryotes) • Translation: • Actual synthesis of a polypeptide under the direction of mRNA • Occurs in ribosomes • In eukaryotes – mRNA must be processed before translation can proceed

  4. Protein Synthesis Challenge • Determine the amino acid sequence for the following DNA template: • TACCCTGCGTTAAGCTACCCAATT

  5. The Triplet Code • The genetic instructions for a polypeptide chain are ‘written’ in the DNA as a series of 3-nucleotides called a codon • ‘U’ (uracil) replaces ‘T’ in RNA

  6. Genetic Code • Each codon encodes for one amino acid • AUG = start codon or methionine • 3 stop codons = UAA, UAG, UGA

  7. Transcription Unit and Terms • RNA polymerase: pries DNA apart and hooks RNA nucleotides together from the DNA code • Promoter region on DNA: where RNA polymerase attaches and where initiation of RNA begins • Terminator region: sequence that signals the end of transcription • Transcription unit: stretch of DNA transcribed into an RNA molecule

  8. Transcription: Overview • Initiation – after RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis on the template strand • Elongation – the polymerase moves downstream, unwinding the DNA and elongating the RNA transcript 5’ to 3’ • Termination – RNA transcript is released, polymerase detaches, DNA completely reseals

  9. Transcription: Initiation • Eukaryotic promoter region contains a TATA box, about 25 nucleotides upstream of start point • Transcription factors bind to TATA box, must occur before RNA polymerase II can attach • RNA polymerase II and additional transcription factors attach forming the initiation complex • Unwinds the DNA and RNA synthesis begins

  10. Transcription: Elongation and Termination • Elongation: • Untwists DNA double helix, exposing 10 to 20 nucleotides • Adds nucleotides to growing 3’ end • Termination: • Transcription terminates when polymerase falls off (not exactly understood how in eukaryotes)

  11. Transcription: Review • Transcription animation

  12. Eukaryotic pre-mRNA structure • 5’ cap – modified guanine nucleotides, thought to function in protecting the reading sequence of DNA, facilitate movement of the mRNA out of the nucleus and aids in ribosome attachment • 3’ poly-A tail – 50-200 adenine molecules, similar functions as 5’ cap, protection, recognition, transport mRNA processing animation

  13. Eukaryotic mRNA Modification • Exons – coding • Introns – non-coding • Must remove the introns from the pre-mRNA to create the mRNA transcript • snRNPs and proteins form spliceosome • Attaches at specific locations on pre-mRNA • RNA transcript is cut, introns removed, exons spliced together • animation

  14. Evolutionary Significance • So what is the biological function of an intron? • Some introns control gene activity in some way • Some introns may be exons, alternative RNA splicing • Multiple domains in one gene • Could lead to evolution of new exons (exon shuffling)

  15. Translation: basic concept • mRNA is moved through a ribosome • Codons are translated into an amino acid sequence, one by one • tRNA molecules bring the amino acids to the ribosomes • Creation of a polypeptide chain

  16. tRNA Structure • Carry amino acids to the ribosomes for translation • Anticodon • 3’ AA attachment site

  17. tRNA Production • Aminoacyl-tRNA synthetase binds an amino acid to its specific tRNA molecule • When attached called an aminoacyl-tRNA • 20 different synthetases, one for each amino acid • 45 different tRNA molecules, but 61 different RNA codons, how is this possible? • 3rd base in anticodon can bond to multiple codons • For example, U can pair with both A and G in 3rd position of tRNA, also some tRNA have inosine (a purine) in the 3rd position which can pair with A, U, or C

  18. Ribosome Structure • Composed of rRNA and protein • Each ribosome has 2 subunits, small and large • Small subunit has mRNA binding site • Large subunit has 3 tRNA binding sites: P (peptidyl-tRNA site), A (aminoacyl-tRNA site), and E (exit site).

  19. Translation: Initiation • mRNA binds to small ribosomal subunit • Initiator tRNA attaches to the start codon AUG • Large subunit attaches with initiator tRNA in p site, uses energy in GTP

  20. Translation: Elongation

  21. Translation: Elongation • The anticodon of an incoming aminoacyl-tRNA base-pairs with the complementary mRNA codon in the A-site • Large subunit catalyzes the formation of a peptide bond between the amino acids attached to the tRNA in both the P and A sites • The growing polypeptide chain is transferred to the tRNA in the A site • The ribosome translocates, moving the “naked” tRNA to the E site for removal, exposing the A site for the next tRNA

  22. Translation: Termination • When ribosome reaches stop codon, ribosome accepts a release factor protein • Hydrolyzes the bond between the tRNA in the P site and the last amino acid in the chain • The 2 subunits and other components dissociate

  23. Translation: Review • Translation animation

  24. Polyribosomes (or polysomes) • Takes approximately a minute to make an average size polypeptide chain • Can have multiple ribosomes on the same mRNA chain • Enable cell to make many copies of a protein very quickly

  25. Gene Expression Overview

  26. Polypeptides and the ER • Proteins destined for export need to be moved through the endomembrane system • Growing polypeptide chain (in cytosol) will have a signal peptide sequence • Signal recognition particle (SRP) guides ribosome to ER

  27. Point Mutations • Mutations are changes in the genetic material of a cell • Point mutations are changes in just one base pair • Can cause genetic disorders, ex. Sickle cell

  28. Types of Point Mutations • Base-pair substitution – the replacement of one nucleotide for another • Silent – no effect • Missense – still codes for an amino acid, but the wrong one • Nonsense – stop codon, premature termination

  29. Other Types of Mutations • Insertions and deletions – additions and losses of nucleotide pairs in a gene, usually more of a problem than substitutions • Frameshift mutations – when the number of nucleotides inserted or deleted is not a multiple of 3, shifts the codon reading frame, can either be missense or nonsense • Mutagen – chemical or physical agent that causes a mutation

More Related