1 / 62

Hypercoagulable States and Thrombosis Why Does This Patient Clot TOO Much?

Hypercoagulable States and Thrombosis Why Does This Patient Clot TOO Much?. Blood Hematopoiesis & Lymphatics Richard A. Marlar May 7, 2013. Hypercoagulable States and Thrombosis Outline. General Causes of Hypercoagulability Venous and Arterial Thrombosis

iman
Download Presentation

Hypercoagulable States and Thrombosis Why Does This Patient Clot TOO Much?

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Hypercoagulable States and ThrombosisWhy Does This Patient Clot TOO Much? Blood Hematopoiesis & Lymphatics Richard A. Marlar May 7, 2013

  2. Hypercoagulable States and Thrombosis Outline • General Causes of Hypercoagulability • Venous and Arterial Thrombosis • Hereditary Thrombosis (Thrombophilia)

  3. Hemostasis and ThrombosisDefinitions • Hemostasis is the stoppage of blood loss from a damaged vessel while continuing to maintain the blood in a fluid state within the vessels. • Thrombosis is the formation of excessive amounts of clot (fibrin and/or platelet derived) within the vessel lumen causing vessel occlusion.

  4. The Balance of Hemostasis Bleeding Thrombosis Regulatory Mechanisms Coagulation Fibrinolysis Thrombosis Bleeding

  5. Types of Hypercoagulability • Local Thrombus Formation: • Venous Thrombosis- Coagulation based • Arterial Thrombosis- Platelet-derived • Systemic Hypercoagulability: • Disseminated Intravascular Coagulation

  6. Arterial Thromboembolic Disease • General Aspects of Arterial Thrombosis • Clot in the arterial system (complete blockage of lumen) • Consists of activated platelets and fibrin (“white thrombus”) • Manifests in mainly MI and Stroke • Also found in larger arterioles • Clinical Symptoms of Arterial Thrombosis • Cold extremities • Gangrene of extremity • Treatment of Arterial Thrombosis • Common causes of death and morbidity • Stop platelet activation and coagulation formation • Anti-platelet drugs and heparin

  7. Venous Thromboembolic DiseaseDeep Vein Thrombosis • Formation of Thrombus in Vein • Fibrin clot with trapped RBC and some platelets • Very common disorder in North America • Affects about 5,000,000 Americans per year • Incidence in North America • 1 in 1000 in general population • 1 in 100 at 75 years of age • Mortality and Morbidity • 21% One year mortality rate in elderly • 30% Recurrent DVT • 30% Post Thrombotic Syndrome

  8. Venous Thromboembolic DiseasePulmonary Embolism Common disorder in North America • Annual incidence 69 per 100,000 • Leading cause of childbirth death • 30% mortality if untreated Mortality • 200,000 deaths per year • 100,000 are preventable • Cause 10% of hospital deaths • Most common preventable hospital death

  9. Clot Formation and BreakdownCoagulation and Fibrinolysis Coagulation Fibrin Clot Fibrinogen D-dimer Fibrinolysis

  10. D-Dimer for Diagnosis of VTETheory • Coagulation generates VTE and then breakdown of fibrin clot forms D-dimers. • D-dimers become elevated in blood after the formation of VTE. • D-dimer levels are elevated in VTE and usually lower in in patients without venous thrombosis • Therefore use the assay to rule out VTE.

  11. Improving D-Dimer Cut-Off ValueEstablishing Cut-off Value Negative for VTE Possibly Positive for VTE Cut-off

  12. Thrombophilia The Genetic Disorders

  13. ThrombophiliaDefinition A set of genetic abnormalities and/or acquired conditions which predisposes the individual to an increased risk of thromboembolic disease.

  14. Concept of Complex Disease • Complex disease is the effect of multiple genes in combination with environmental factors. • No clear-cut pattern of inheritance. • Each risk factor may have a weak affect. • Many genes involved. • Genes may be different for same disease. • Genes are difficult to identify.

  15. Thrombotic Risk FactorsCategories • Physiologic: Age and Gender • Genetic: Hemostatic and Non-Hemostatic • Acquired: Behavioral and pathologic

  16. Venous ThrombosisPredisposing Factors • Clinical Causes: • Surgery and trauma • Cancer • Immobilization • Hereditary Factors: • Thrombophilia as a Complex Disease • Protein C, Protein S, Antithrombin • Prothrombin-20210, FVLeiden • Acquired Factors: • Lupus Anticoagulant • Hormones (BCP, HRT, Pregnancy)

  17. Prothrombotic Threshold ParadigmNormal Example Threshold for VTE LA BCP Pregnancy Normal

  18. Prothrombotic Threshold ParadigmThrombotic Example Thrombosis Threshold for VTE LA BCP Pregnancy Factor V Leiden Normal

  19. Clinical Aspects of Thrombophilia • Presents with mainly venous thrombosis • Usually manifests in young adults (20-50 years) • Cause of thrombotic presentation: • Spontaneous • Inciting Event • Complex Genetic Disease- No single cause • Standard treatment for all causes

  20. Risk Factor • A condition in which the patient has a “greater than normal” chance to develop thrombosis. • Genetic or Acquired • Molecular Causes: • Loss of Function • Gain in Function • Risks greater than sum of single gene. • Many factors still unknown.

  21. Genetic Antithrombin Protein C Protein S Factor VLeiden Prothrombin-20210 Factor VIII Homocysteine Dysfibrinogenemia Acquired Cancer Atrial Fibrillation Previous thrombosis Smoking BCP Pregnancy Lupus Anticoagulant Immobilization Age Genetic and Acquired Risk Factors for Thrombosis

  22. AT, PC, PS Factor VLeiden Prothrombin-20210 Homocysteine Lupus Anticoagulant Dysfibrinogenemia Others Unknown 8-10% 12-18% 5-15% 5-15% 10-20% 2-4% 2-5% 20-50% Prevalence of Abnormalities in Patients with VTE

  23. APC-ResistanceFactor VLeiden • Inability of patient’s plasma to be inhibited by Activated Protein C (APC) • Mutation of APC cleavage site in Factor V • Specific polymorphism known as FVLeiden • Amino acid #506 is Arginine • Mutated to Glutamine- one base pair change • Relative Risk: 2.0-2.5

  24. Prothrombin-UT 20210 Mutation • Polymorphism at bp 20210 in 3’ UT • Increases Prothrombin Levels (?) • Mechanism: longer surviving mRNA • Genetic Abnormality • Heterozygote and Homozygote • Assay: DNA based only • Relative Risk: 2-3

  25. Prothrombin-20210 Gene Polymorphism • Gln Lys Val Ile Asn Gln Phe Val Glu Stop • CAG AAG GTC ATT GAT CAG TTT GGA GAGTAGGGGGCCACTC • ATATTCTGGGGGTTCCCAAT AAAAGTGACT CTCAGCGAGC CTC • AATGCTC CCAGTGCTATAGAAGACTTA AGAATCCACC ACCTGGT • GCA CGCTGGTAGT CCGAGCAC

  26. Incidence of Factor VLeiden and Prothrombin-20210 in US Population Ethnicity FVLeiden FII 20210 Caucasian 4.0% 3.0% African-American 0.5% 0.3% Asian American 0.2% 0.1% Hispanic 2.3% 2.9% Native American 0.2% 0.1% Other genetic factors (PC, PS, etc) are distributed evenly throughout the ethnic groups.

  27. Antithrombin Deficiency • First reported inherited thrombophilic state • Most severe of the inherited disorders • Not common (<1% for first VTE) • AT Levels: 30%-60% • Age of Onset: 15 to 30 Years • Inherited and Acquired Deficiencies • Autosomal Dominant Inheritance • Assay Types: • Chromogenic • Antigenic

  28. Clinical Aspects of Protein C • Autosomal gene with variable penetrance(?) • Not ethnic specific • Estimated Prevalence of heterozygous protein C deficiency: • Symptomatic prevalence is 1 in 8,000 • Asymptomatic prevalence is 1 in 300

  29. Protein S Deficiency • Inherited Deficiencies • Multiple gene defects • Autosomal dominant inheritance • Variable penetrance • Age of Onset: 15 to 50 years • Acquired Deficiencies • Pregnancy and OCP/HRT use • Inflammation and acute thrombosis • Various Assays Types • Functional • Total and Free PS Antigen (recommended)

  30. Protein S RegulationLaw of Mass Action C4b BP Protein S Protein S Bound (not active) 60% Free (Active) 40%

  31. Anti-Phospholipid Syndrome General Aspects • Heterogeneous Family of Auto-Antibodies • Lupus Anticoagulant • Antibodies Against PL-Protein Complex • Cause: • Drugs and Antibiotics • Infectious Agents • Auto-immune Disease • Asymptomatic patients

  32. Anti-Phospholipid Syndrome General Aspects • Majority of LA are Asymptomatic! • ~30% of LA patients develop thrombosis • ~2% of the General Population • Transient or Long Term • Transient- Viral Infection • Long Term • Auto-immune disease • Unknown Cause

  33. Anti-Phospholipid Syndrome General Aspects • Thrombosis and Obstetrical Complications • Arterial- Stroke and MI • Venous- DVT and PE • Obstetric- Recurrent Fetal Loss • Laboratory testing • Order a series of tests (LA panel) • Confirm: Must be present on 2 occasions at least 12 weeks apart

  34. Why Evaluate for Thrombophilia • Educate asymptomatic individuals • Provide genetic counseling • Provide prophylactic therapy for high risk • More appropriate anticoagulant therapy for symptomatic individuals • More specific therapy when available.

  35. Laboratory Evaluation of Thrombophilia • Evaluations are complex and variable • Provider preferences • Hospital and laboratory demands • Evaluations have and will change over time • Evaluations can be expensive: • Simple work up: $600 - $800 • Extensive work up: $1200 - $2000 • Evaluations should be stratified: • Age • Gender (?) • Ethnicity (?)

  36. When Should a Patient be Worked Up? • Optimum Time: Asymptomatic and No Therapy • Symptomatic and Anticoagulants: SHOULD NOT TEST FOR PLASMA BASED ASSAYS • Any Time: Genetic Assays

More Related