1 / 13

INTERLEUKIN-6 GENE POLYMORPHISMS AND SURVIVAL AFTER ALLOGENEIC HAEMATOPOIETIC STEM CELL TRANSPLANTATION

INTERLEUKIN-6 GENE POLYMORPHISMS AND SURVIVAL AFTER ALLOGENEIC HAEMATOPOIETIC STEM CELL TRANSPLANTATION. Z. Ambruzova 1 , L. Raida 2 , P. Jindra 3 , B. Vidan-Jeras 4 , F. Mrazek 1 , E.Faber 2 , J. Onderkova 1 , J. Pretnar 5 , K. Indrak 2 , M. Petrek 1

ivory
Download Presentation

INTERLEUKIN-6 GENE POLYMORPHISMS AND SURVIVAL AFTER ALLOGENEIC HAEMATOPOIETIC STEM CELL TRANSPLANTATION

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. INTERLEUKIN-6 GENE POLYMORPHISMS AND SURVIVAL AFTER ALLOGENEIC HAEMATOPOIETIC STEM CELL TRANSPLANTATION Z. Ambruzova1,L. Raida2, P. Jindra3, B. Vidan-Jeras4,F. Mrazek1, E.Faber2, J. Onderkova1, J. Pretnar5, K. Indrak2, M. Petrek1 1Laboratory of Immunogenomics, Dept. of Immunology, 2Department of Haematooncology, Medical Faculty Palacky University and University Hospital Olomouc, Czech Republic, 3Department of Haematology and Oncology, University Hospital Pilsen, 4Blood Transfusion Center of Slovenia, 4Department of Haematology, University Clinical Centre Ljubljana, Slovenia Supported by Czech Govt. Funding MSM 6198959205 and IGA MZCR NR9099

  2. BACKGROUND • the allogeneic haematopoietic stem cell transplantation (aHSCT) outcome is substantially influenced by various factors on the side of the recipient and/or donor • different non-HLA genetic systems are studied for their potential effect on graft-versus-host disease (GVHD), infections, transplant-related mortality and overall survival (Dickinson 2005) • the identification of particular gene variants as the risk factors for development of posttransplantation complications could be used for their prediction, prevention and individual treatment

  3. INTERLEUKIN-6 • interleukin-6 (IL-6) is a pro-inflammatory cytokine produced by broad spectrum of cell types • IL-6 is involved in pathogenesis of the immune-mediated complications of aHSCT • IL-6 production is affected by functional single nucleotide polymorphism in the promoter region at the position -174 G/C (G allele is associated with increased IL-6 levels) (Fishman 1998) • IL-6 gene polymorphism of the recipient and/or the donor was associated with acute or chronic GVHD in several studies (Cavet 2001, Socie 2001, Rocha 2002, Mullighan 2004, Karabon 2005)

  4. AIM OF THE STUDY to investigate if there exists an association between: IL-6 gene polymorphisms -174 G/C and/or nt565 G/A Overall survival Transplant-related after aHSCT mortality in 1st year after aHSCT* * death from any cause, other than progression of the underlying disease during 1 year after aHSCT

  5. INVESTIGATED SUBJECTS Number of donor-recipient pairs 166 center Olomouc 88 center Ljubljana 53 center Pilsen 25 Median age, years (range) Donor HLA compatibility patients 43 (17-64) identical 166 donors 40 (16-70) mismatched 0 Recipient sex Donor type female 72 sibling 117 male 94other related donor 4 Diseases unrelated 45 acute leukemia (AML, ALL) 96Graft source chronic leukemia (CML,CLL) 26 PBSC 144 NHL 14 BM 22 other30Sex of donor and recipient Conditioning regimen male with female donor 35 non-myeloablative 70 all others combinations 131 myeloablative 96

  6. METHODS 1. Genotyping Polymerase Chain Reaction with Sequence Specific Primers(PCR-SSP) IL-6-174 G/C (rs1800795) (primers adopted from Marshall 2001) Specific 1 (wild type) *G: 5´AATGTGACGTCCTTTAGCATG3´ Specific 2 (mutant type) *C: 5´AATGTGACGTCCTTTAGCATC3´ Constant: 5´TCGTGCATGACTTCAGCTTTA3´ IL-6 nt565 G/A (rs1800797) (primers designed according to the reference IL-6 gene sequence NT_007819.16) Specific 1 (wild type) *G: 5´TAACTGCACGAAATTTGAGGG3´ Specific 2 (mutant type) *A: 5´TAACTGCACGAAATTTGAGGA3´ Constant: 5´TCTGAACTGAGTTTCCTCTGA3´ 2. Statistics Conformity to the Hardy-Weinberg equilibrium: Chi-square test Overall survival and 1st year TRM statistics: Kaplan-Maier analysis, Log-rank test (comparison between genotypes)

  7. RESULTS • decrease of overall survival among IL-6-174 GG (p=0.026) or GC recipients (p=0.042) compared to CC homozygous individuals (Figure 1) • shorter overall survival in IL-6 nt565 GG homozygotes than in patients with AA genotype (p=0.03) (Figure 2) • higher probability of 1 year TRM in group of recipients with IL-6-174 and nt565 GG genotypes compared to those with IL-6-174 CC (p=0.016) and IL-6 nt565 AA (p=0.022) genotypes (Figure 3) • no effect of IL-6 gene polymorphisms of the donor for overall survival or TRM was observed

  8. Genotype and allele frequencies of the IL-6 SNPs in the groups of patients and donors * Distribution of genotypes in particular groups was in compliance with Hardy-Weinberg equilibrium Both IL-6 SNPs were in tight linkage disequilibrium

  9. Figure 1: Comparison of overall survival after aHSCT according to IL-6-174 genotypes of the recipient Mean survival: GG genotype 28.5 months GC genotype 43.6 months CC genotype 53.3 months Log-rank test: GG vs. CC p=0.03 GC vs. CC p=0.04

  10. Figure 2: Comparison of overall survival after aHSCT according to IL-6 nt565 genotypes of the recipient Mean survival: GG genotype 27.4 months GA genotype 46.2 months AA genotype 50.7 months Log-rank test: GG vs. AA p=0.03

  11. Figure 3: Probability of TRM according to recipient IL-6-174 and nt565 genotypes IL-6-174 GG vs. CC p=0.016 IL-6 nt565 GG vs. AA p=0.022 Probability Probability IL-6-174 GG genotype IL-6 nt565 GG genotype IL-6-174 CC genotype IL-6 nt565 AA genotype Months Months Mean survival: Mean survival: GG genotype 8.8 months GG genotype 8.8 months CC genotype 10.8 months AA genotype 10.7 months

  12. CONCLUSION Our study revealed association between IL-6-174 GG and IL-6nt565 GG genotypes and decreased overall survival and increased one year TRM after aHSCT in Czech and Slovenian patients after aHSCT. This data suggest that IL-6 gene polymorphisms, beside its impact on development of graft versus host disease, may affect also survival after aHSCT.

  13. REFERENCES Cavet J, Dickinson AM, Norden J, Taylor PR, Jackson GH, Middleton PG: Interferon-gamma and interleukin-6 gene polymorphisms associate with graft-versus-host disease in HLA-matched sibling bone marrow transplantation. Blood 2001;98:1594-600 Dickinson AM, Middleton PG, Rocha V,Gluckman E, Holler E; Eurobank members: Genetic polymorphisms predicting the outcome of bone marrow transplants. Br J Haematol 2004;127:479-90 Fishman D, Faulds G, Jeffery R, Mohamed-Ali V, Yudkin JS, Humphries S, Woo P: The effect of novel polymorphisms in the interleukin-6 (IL-6) gene on IL-6 transcription and plasma IL-6 levels, and association with systemic-onset juvenile chronic arthritis. J Clin Invest 1998;102:1369-76 Karabon L, Wysoczanska B, Bogunia-Kubik K, Suchnicki K, Lange A: IL-6 and IL-10 promoter gene polymorphisms of patients and donors of allogeneic sibling hematopoietic stem cell transplants associate with the risk of acute graft-versus-host disease. Hum Immunol 2005;66:700-10 Marshall SE, McLaren AJ, McKinney EF, Bird TG, Haldar NA, Bunce M, Morris PJ, Welsh KI: Donor cytokine genotype influences the development of acute rejection after renal transplantation. Transplantation 2001;71:469-76 Mullighan C, Heatley S, Doherty K, Szabo F, Grigg A, Hughes T, Schwarer A, Szer J, Tait B, To B, Bardy P: Non-HLA immunogenetic polymorphisms and the risk of complications after allogeneic hemopoietic stem-cell transplantation. Transplantation 2004;77:587-96 Rocha V, Franco RF, Porcher R, Bittencourt H, Silva WA Jr, Latouche A, Devergie A, Esperou H, Ribaud P, Socie G, Zago MA, Gluckman E: Host defense and inflammatory gene polymorphisms are associated with outcomes after HLA-identical sibling bone marrow transplantation. Blood 2002;100:3908-18 Socie G, Loiseau P, Tamouza R, Janin A, Busson M, Gluckman E, Charron D: Both genetic and clinical factors predict the development of graft-versus-host disease after allogeneic hematopoietic stem cell transplantation. Transplantation 2001;72:699-706

More Related