1 / 24

Pit1 Gene Polymorphism in Swamp Buffalo and FH Cows

This research identifies Pit1-HinfI polymorphisms in Indonesian swamp buffalo and FH cows and estimates allelic and genotypic frequencies.

Download Presentation

Pit1 Gene Polymorphism in Swamp Buffalo and FH Cows

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Identification Polymorphism of Pituitary-Specific Positive Transcription Factor 1(Pit1) Gene in Indonesian Swamp Buffalo (Bubalusbubalis) and Holstein-Friesian Cows R. Misriantia , C. Sumantria, and A. Farajallahb a) Faculty of Animal Science, Bogor Agriculture University b) Faculty of Biology Sci., Bogor Agriculture University

  2. INTRODUCTION

  3. introduction Conventional farming 95 % 1 source : Direktorat Jenderal Peternakan, 2006

  4. selection mating introduction Increase animal productivity 2

  5. introduction • Selection of animals with higher growth rate and better carcass composition is of great significance to breeders and consumers. • Current technologies enable scientists to improve on the accuracy and efficiency of traditional selection methods by applying genetic markers through marker-assisted selection. • Pit1 gene are among the genes involved in mammalian productivity 3

  6. introduction • Gene Pit1 there is in the chromosom 1 , consisting 6 exon and 5 intron • Moody et al (1995) identified in bovines the A and B alleles of the Pit1/Hinf I polymorphism, which is an exon 6, A to G silent mutation of the bovine Pit1 gene 2

  7. introduction Pituatary development 1 Pit1 gene Thyroid Stimulation Hormone Prolaktin hormone 3 2 5

  8. introduction introduction The aim of this research to identify the Pit-1-HinfI polymorphisms and estimate allelic and genotypic frequencies in Indonesian swamp buffalo and FH cows. 6

  9. METODHS

  10. Material (whole blood Sampel ) 7

  11. Material (PCR) 8

  12. Material and Method 9

  13. Data Analysis The allelic frequencies were calculated by Nei (1987) Yi = (2nii + ∑nij) / (2N) 10

  14. RESULT

  15. Result and discussion The amplification of the pit1 gene fragment resulted in a single product of 611 bp. In homozygous animals shows ( 611bp, AA variants) or two bands (367 bp and 244 bp, BB variant). Heterozygous animal gave a three band (611, 367 and 244 bp) 11

  16. Result and discussion Figure 1 shows the restriction pattern of three genotypes AA, AB and BB upon digestion of the PIT-1 HinfI in FH cows M AA BB AB 600 pb 300 pb 100 bp 12

  17. Result and discussion 881 ctggtaaaaggagcctacatgagacaagcatctaaatgttcaaaaaaact 931 tcacatttattattgttgaaaagctttgaaggtgttttcagcgtctttag 981 gtttcctttttacgttaatgttagtactaatatttaggaaatgtaaccta 1031 acttgattttgatgggcctaaaccatcatctcccttctttcctgccaact 1081 ccccacctcccagtattgctgctaaagacgccctggagagacactttgga 1131 gaacagaataagccttcctctcaggagatcctgcggatggctgaagaact 1181 aaacctggagaaagaagtggtgagggtttggttttgtaaccgaaggcaga 1231 gagaaaaacgggtgaagacaagcctGagtcagagtttatttactatttct 1281 aaggagcatctcgaatgcagataggctctcctattgtgtaatagcgagtg 1331 tttctacttttcattcctttctcttctccagccaaaatagaaattagtta 1381 tttggttagcttcaaaaaatcacatcagtaatttttgcagaagtgtttct 1431 ttcctactttaaaaataaatacaatttaaattatgttgatgaattattct1481 cagaaggcacattgtacattt A Sequence analysis of the polymorphic HinfI site revealed a mutation at position 1256. The mutation was a G to A transition. 13

  18. Figure 1 shows the restriction of the PIT-1 HinfI in swamp buffalo M BB BB BB BB BB BB 400 pb 367 pb 300 pb 244 pb 200 pb 100 pb In 320 buffalo analyzed, the overall genotype frequencies were BB (100%) 14

  19. Result and discussion Genotype and gen frequencies of Pit1-Hinf1 in Buffalo population 15

  20. Result and discussion Genotype and gen frequencies of Pit1-Hinf1 in FH cows 17

  21. Result and Discussion 18

  22. conclution Frequency of B allele is highest than A allele. In Indonesian swamp buffalo, the overall genotype frequencies were BB (100%), but in 45 FH analyzed, genotype frequencies were 0,02 for AA, 0,44 for AB, and 0,53 for BB. Gene frequencies of allele A and B were 0,25 and 0,75, respectively. 19

  23. Thank you

  24. 22

More Related