Unnatural Protein Engineering: Biochemical and Medicinal Applications

1. Unnatural Protein Engineering:Biochemical and Medicinal Applications Youngha Ryu Department of Chemistry Texas Christian University

2. Methods of Protein Modification • Chemical modification of the reactive side chains • Total chemical synthesis • Ligation of synthetic peptide to a truncated protein • In vitro transcription/translation • Expression in living organisms

3. aa~AMP tRNA H2N EF-Tu Protein biosynthesis machinery DNA Aminoacyl-tRNA synthetase (aaRS) mRNA transcription aminoacylation peptide chain acylated tRNA mRNA ribosome translation

4. “Standard” Genetic Codes

5. PNAS48, 1086 (1962)

6. Suppressor tRNAs

7. Nonsense Suppressors in E. coli

8. In vitro System P. G. Schultz et al. Science1989, 244, 182

9. Incorporation of unnatural amino acids into proteins in living organisms • Efficient transport or biosynthesis of unnatural amino acids • Unique codons (nonsense, four base, etc) • tRNA/aminoacyl-tRNA synthetase pair that is orthogonal to the endogenous system • Directed evolution of the aminoacyl-tRNA synthetase to selectively charge the orthogonal tRNA with an unnatural amino acid

10. pC C G G C G AOH G C C A G G C C G C C G C C G G C G C A U An “Orthogonal” pair from M. jannaschii 3' • M. jannaschii tRNATyr is orthogonal to E. coli synthetases • M. jannaschii TyrRS is orthogonal to E. coli tRNAs • M. jannaschii TyrRS has minimal interaction with anticodon • M. jannaschii TyrRS has no proofreading activity 5' A T A U C G C G G C C A A C A U U G A G G C U G G C U U G C G A A C G G A G U A G U A C U G C A U

11. Directed Evolution of Mj TyrRS

12. Selection strategy Wang, Brock, Herberich & Schultz Science 292, 498,(2001)

13. Synthetases for Unnatural amino acids Turner, Graziano, Spraggon & Schultz J. Am. Chem. Soc.,127, 14976 (2005) Proc. Natl. Acad. Sci., 103, 6483 (2006)

14. Expanded Genetic Code in E. coli

15. Sub-optimal yields of proteins in E. coli • Non-versatile two plasmid system? – Integration of the synthetase and tRNA genes into a single plasmid, which is compatible with most E. coli expression vectors and strains • Intrinsic low efficiency due to the competition with termination? – High suppression efficiency is achieved by naturally occuring non-sense suppressors (e.g. XL1-Blue) • Inefficient transcription and processing of tRNA? – New promoter and flanking sequence • Inefficient expression of aminoacyl-tRNA synthetase? – New promoter

16. New Mj tRNA expression cassette • E. coli prolyl tRNAs have C1-G72 pair, which is major identity determinant of MjtRNA – Important context for the precise tRNA processing • proK tRNA is most frequently used in E. coli • FIS enhances tRNA transcription Terminator JYTRN

17. Mutant glnS promoter enhances the synthetase expression -35 region -10 region +1 WT AAAAAACTAACAGTTGTCAGCCTGTCCCGCTTATAAGATCATACGCCGTTATACGTT Mutant AAAAAACTAACAGTTGTCAGCCTGTCCCGCTT-TAATATCATACGCCGTTATACGTT WT Mutant BpaRS

18. Asp286Arg (D286R) substitution enhances tRNA(CUA) binding affinity TyrRS (WT) – tRNATyr (WT) TyrRS (WT) – tRNATyr (CUA) TyrRS (D286R) – tRNATyr (CUA) His283 Asp286 Asp286 Asp286 Arg286 G34 G34 C34 C34 Phe261 Km= 0.35 mM kcat= 0.19 s-1 kcat/Km (relative) = 1 Km= 39 mM kcat= 0.070 s-1 kcat/Km (relative) = 0.0033 Km= 0.68 mM kcat= 0.079 s-1 kcat/Km (relative) = 0.22 Kobayashi et. al.Nat. Struct. Biol.10, 425 (2003)

19. Polycistronic expression of MjtRNA aaRS promoter glnS glnS glnS glnS’ glnS’ glnS’ tRNA promoter - lpp proK proK proK proK tRNA copy # 0 1 1 1 3 6 JYTRN

20. b-Galactosidase assay for suppression efficiency TAG araBAD promoter leader lacZ proK proK + D286R proK + glnS’ proK + glnS’ + D286R + 3TRN + 6TRN

21. Efficient incorporation of many different unnatural amino acids

22. Efficiency and fidelity

23. Optimizing protein yields in E. coli • E. coli prolyl-tRNA promoter and terminator for the amber suppressor tRNA • Mutated form of the glnS promoter for the synthetase • D286R substitution in the synthetase gene • Multiple copies of the suppressor tRNA gene • Yield of adiponectin (Glu123Bpa) mutant: 0.4g/L Ryu & Schultz Nat. Methods3, 263 (2006)

24. Site-selective modification of proteins http://www.ambrx.com

25. Photocaged Tyrosine Tyr503 lactose Deiters, Groff, Ryu, Xie & Schultz Angew. Chem. Int. Ed.45, 2728 (2006)

26. Incorporation of a distance probe into proteins Tsao, Summerer, Ryu & Schultz J. Am. Chem. Soc. 128, 4572(2006)

27. Incorporation of an IR probe into proteins pCNPhe Ferrous (Fe2+) adducts Ferric (Fe3+) adducts Met-ferric [2248 cm-1] Deoxyferrous [2233 cm-1] CO [2239 cm-1] Azide [2234 cm-1] NO [2230 cm-1] Cyanide [2236 cm-1] O2 [2230 cm-1] • __ Schultz, Supekova, Ryu, Xie, Perera& Schultz J. Am. Chem. Soc.128, 13984 (2006)

28. Co-translational protein modification Thrombin Thrombin Desulfo-hirudine Sulfo-hirudine Ki = 307 fM Ki = 26 fM Liu & Schultz, Nat. Biotech.24, 1436 (2006)

29. Incorporation of an NMR probe TE domain of the human FAS Cellitti et. al. J. Am. Chem. Soc.130, 9268 (2008)

30. Unnatural amino acids incorporated by the mutant TyrRS in E. coli

31. Identification of the protein modification and secretion pathways by photo-crosslinking in E. coli • N-Acetylation of recombinant proteins in E. coli • Na-Acetylation (e.g. Z-domain etc) • Ne-Acetylation of lysine side chains (e.g. Porcine and bovine somatotropins) • Secretion pathway of the YebF protein in E. coli

32. N-Terminal acetylation of the Z-domain depends on E. coli strains and expression plasmids

33. N-Terminal acetylation of the Z-domainis context-dependent

34. Photo-crosslinking and proteomics analysis Marker Control S3Bpa V4Bpa D5Bpa kDa 220 - 2 2 80 - 3 50 - 1 1 1 30 - 20 - 15 - 10 -

35. Strategy to identify the YebF transporter

36. Unnatural protein medicinal chemistry

37. Directed evolution of the archaea LeuRS system

38. Selection with a single reporter plasmid + Unnatural amino acid Positive selection + Cm + Uracil Next round of positive selection Survivors containing aaRS capable of charging any natural or unnatural aa on the orthogonal tRNA - Unnatural amino acid Negative selection + 5-FU Cells that incorporate natural amino acids make toxic product from 5-FU and die; Cells that incorporate unnatural amino acid only survive on 5-FU

39. Minimal media + Uracil Minimal media + Uracil + Uridine Deletion of the upp and pyrF genes by the recombinase-based gene replacement GeneHog D upp D pyrF

40. Summary • A single plasmid system for the high yield expression of proteins containing unnatural amino acids • Broad applications depending on the physicochemical properties of unnatural amino acids – chemical and photochemical reactions, spectroscopic probes, novel therapeutics etc. • Ongoing projects • Identification of the protein acetylation and secretion pathways • Unnatural protein medicinal chemistry • Directed evolution of the leucyl-tRNA synthetase

41. Acknowledgments Graduate Students • Minoro Aoshima • Lina Bernal-Perez • Pradeep Budhathoki • Aery Lee Undergraduate Students • Kiran Butt • Michael Foster • Brett McKnight • Fatima Sahyouni • Diana Tran Collaborators • Dr. Laszlo Prokai (UNTHSC) • Dr. Peter Schultz (TSRI) Financial Support • TCU (Start-up, RCAF, SERC)