1 / 51

Recall Notes on DNA!

Unit 4 - Molecular 
Genetics. Recall Notes on DNA!. Complete Lab Exercise 4.1.1: Evidence of Hereditary Material. DNA Replication and Repair. During cell division in eukaryotic cells, the replicated genetic material in the nucleus is _____ ________________________________________.

josiah
Download Presentation

Recall Notes on DNA!

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Unit 4 - Molecular 
Genetics Recall Notes on DNA!

  2. Complete Lab Exercise 4.1.1: Evidence of Hereditary Material

  3. DNA Replication and Repair During cell division in eukaryotic cells, the replicated genetic material in the nucleus is _____ ________________________________________. It is important that each _________________has an ___________of the parent cell’s DNA.

  4. DNA replication is ____________________

  5. Steps to Replication 1. Replication begins at a ________________on the DNA known as the ___________________.

  6. The two strands of DNA are held together by ______________and are twisted to form a ________________. To expose a __________________, the DNA must be ___________. 2. The _________________________________ the double helix by breaking the __________________between base pairs. 3. Base pairs want to ___________, so ____________________ ________________________bind to the exposed DNA single strands and ____________________________

  7. 4. _________________ is an enzyme that relieves any _____________ brought about by the _______________ of the DNA (bacteria) __________ _____ both strands of DNA, allowing them to ___________, then _____________ the cut strands.

  8. Replication begins in ___________________from the origin(s) ______________________________________ ____________________________are built as soon as an area of the DNA has been unwound. Where two strands of DNA are unwound, where they are joined is called _______________________________ DNA replication moves _______________________________________ __________________________________________________________

  9. ______________________________are the three enzymes known to function in _____________________. __________________requires a template to start synthesizing a new complementary DNA strand. 5.The enzyme _______________ lays down _______________that will be used by _________________________as a starting point to build

  10. 6. DNA polymerase III adds the appropriate ___________________ _______________________________ to the __________of the new strand using the template strand as a guide.

  11. ____________________is built continuously __________ the replication fork. (5' to 3') ___________________composed of short segments of DNA, known as ____________________, is built in pieces ______ from the replication fork.

  12. 7. __________________excises the ________________and replaces them with the appropriate deoxyribonucleotides. 8. ______________joins the gaps in the ______________by the creation of a ____________________ bond. 9. __________________________________. If mistakes are found the act as an ____________________, excising incorrectly paired nucleotides and replacing.

  13. DNA Organization In the nucleus, the human genome is organized into _____________________ Chromosomes consist of DNA wrapped around protein - called _______________ Every __________ nucleotides, the DNA is coiled around a core group of __________ ____________________, known as ___________________. (+vehistones attracted to -ve charged DNA. ________________= nucleosome _______________________ coil into chromatin fibres. Chromatin fibres then ___________________ into chromatin Chromatin coils again to form a ________________________

  14. Different organisms have different # of 
chromosomes. ____________________of DNA codes for proteins. ________ of the human genome is _________________.

  15. Noncoding regions are filled ________________________________ (repeating sequences - TAGTAGTAGTAG) The ____________________________have long sequences of repetitive noncoding DNA, known ______________________. Repetitive DNA sequences are also found in the region of the_____________________, which play a role ___________________. Chromosomes also contain _________________________. (sequence similar to a functioning gene _______________________). Two types - LINEs ___________________________________________ SINEs ____________________________________________ The function of LINEs and SINEs is not clear.

  16. Protein Synthesis ____________________experiments with garden peas laid the foundation for genetics. His results led to the idea that “____________” were responsible for the patterns of inheritance Today these are known as ____________, and they direct the production of ______________.

  17. Garrod’s Hypothesis The physician Archibald Garrod was the first to hypothesize that ______________________________________in 1909

  18. George Beadle and Edward Tatum Thirty-three years later, these 2 were able to demonstrate _______________ the relationship. 
Summarized this relationship as the _______________________________.

  19. Vernon Ingram Now known as the ___________________________ (genes also code for _____________) V.I. demonstrated the relationship while studying the ______________________of hemoglobin from individuals with _____________________.

  20. Even though this an effective way to think of genes, science has recently ___________________________and found that there seem to be "only" about _____________. The problem is humans produce at least ______________ different _____________________ !! The research is still ongoing today, but it looks like a ___________ can code for _______________. (More later)

  21. So how are proteins made? DNA contains the __________________, but their seem to be many complications if it is the DNA that gives rise to protiens: - DNA is too _________________ to be allowed out of the __________. - Only ___________of DNA in a cell:  Protein is required ____________________.  Proteins need to be _______________________________ The answer is _____________________. DNA is ________________into an RNA message and then ____________

  22. Transcription Transcription can be divided into three sequential processes: 1. __________________ 2. __________________ 3. __________________. 1. Initiation Transcription begins when the ______________________binds to the segment of DNA that is to be ____________________and ______________________________________ It binds to the DNA molecule_____________ of the gene to be transcribed. This region is a sequence on one strand of DNA called the _________________. In most genes it looks like ___________________________________________________

  23. ____________________binds to the _______________ which is the strand of DNA that is used as a ____________ to build _________________________________ The other strand of DNA is the _______________and is ___________transcription. It will be identical in sequence to ________

  24. 2. Elongation • The __________________________opens the double helix • - It starts building _________ in the direction of ____________. • - RNA polymerase __________________________________. • - The ________________ itself does not _______________. • - The process is similar to that of _______________________.

  25. AGCTTCCGAGATACAGTAATAGC

  26. 3. Termination Elongation continues until __________________recognizes the end of the gene - ________________________. At the _____________________, the newly synthesized mRNA disassociates, ____________________ and the RNA polymerase released.

  27. Posttranscriptional Modifications The mRNA (known as ____________________________) needs to be ___________ before leaving the nucleus. A ____________is added to the start of the primary transcript. This __________protects the _________________________as it exits the nucleus. It also plays a role in the ________________________. A string of approximately ______________are added to the ________________

  28. Genes also contain ___________ regions (_________________) and _________ regions (known as ________________). The __________ are interspersed among _______________; _____________________must be removed. The _______ are removed by ________________________. _______________cut out the _________ and join the remaining _______.

  29. The _______________________. Unlike DNA replication, there is ____________________enzyme. This results in more _________________. Genes are transcribed ________________, so ______ ______________________compared to DNA replication.

  30. Only 30000 genes??? E T I M

  31. mRNA TRANSLATION Once in the ___________ the mRNA it can be ________________. _____________________ is the process of ____________________of the mRNA into ________________ ___________________indto the mRNA, recognizing the ___________in eukaryotes. The ribosome consists of two subunits, _____________________________________. The two subunits clamp around the mRNA and proceed along the mRNA in the ____ ____________________________________________________________________to the growing polypeptide chain

  32. Reading Code There are _______________but only _________________in mRNA. To code for ________________, a sequence of _________ is used for each amino acid. Each _________ is called a __________. Each __________________________________
and more than one __________ can code for a __________________. This redundancy minimizes _________ 
that may lead to ___________________. One _______ serves as the ______________and others serve as _______________ The mRNA is ___________________

  33. Using the genetic code, decipher the following mRNA sequence: 5' - GGCAUGGGACAUUAUUUUGCCCGUUGUGGUGGGGCGUGA - 3'

  34. The genetic code is _____________.The same ______________is used for translation in ______ ____________ from ________________ with only a few isolated exceptions. tRNA In order to synthesize the ____________the ribosome requires the ______________ to be delivered to it. __________________________________.

  35. tRNA's structure resembles a _____________where one arm of tRNA, a sequence of _________________________________recognizes the _________________________ The other arm carries the ____________________________

  36. Every tRNA carries only ___________________ 
(aminoacyl-tRNA) Therefore at least _____ different ______ are required, but ________________means ____ 
possible different types of _______ It has been observed that sometimes ____________of an anticodon are needed _______________. For example the anticodon______________________________which both code for ____________. This flexibility makes it possible for ________________to be added despite ___________________________of mRNA.

  37. The first codon is the ____________________. This means that every ______________________ __________________________ The ribosome has two sites for tRNA: 
 Here is how it works: 1. The tRNA that carries _________________________. 2. The next tRNA______________________. 3. ____________ is bonded to the _________________. 4.Next the ribosome ____________________________.

  38. This process continues, growing the ____________________ The tRNAs that have been released are recycled by ____________________________________________ The ribosome will eventually reach ________________.

  39. A protein known as a release factorrecognizes that the ribosome has stalled and 
releases the polypeptide chain from the 
ribosome by releasing the 2 subunits of the 
ribosome. Final modifications may include sugars 
(glycosylation) or phosphate being added to 
some of the amino acid residues and the 
peptide may also be cleaved at specific places

More Related