1 / 14

D.N.A

D.N.A. Deoxyribose Nucleic Acid. -DNA is found in every cell in our bodies. -Every persons DNA is a mixture from their parents DNA.

kaori
Download Presentation

D.N.A

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. D.N.A Deoxyribose Nucleic Acid

  2. -DNA is found in every cell in our bodies. -Every persons DNA is a mixture from their parents DNA. -Your egg or sperm cells only contain half of your DNA so when you have children, they receive one half of their DNA from you, and one half from their other parent. As such, every persons DNA is unique to them.

  3. DNA is made of only a few things. Sugar, phosphate, and nitrogen bases. The nitrogen bases are important. There are only 5, and only 4 of them are common. Guanine, Adenine, Thymine and Cytosine OR G A T C To get the spiral structure you can see, G and C bind together, and A and T bind together.

  4. Can you write out the other side of this strand of DNA? GAATCCCCGGTAAAGCTCGATCGT Remember: G+C and T+A

  5. The ‘bases’ (GATC) make up DNA and DNA makes us. It is a set of instructions for how to build us. We can take a sample of DNA and look at it very closely to find out what bases (GATC) it has and in what order. We can also take DNA and find out what groups of bases it has and in what order.

  6. DNA Fingerprinting involves taking a sample of someone’s DNA and finding out what bases that person has and in what order. We do this using Gel Electrophoresis. See your handout for an explanation on how this is done.

  7. This is what a gel looks like when it is finished. This gel has had 10 different samples of DNA run through it at once.

  8. At a crime scene, we can get DNA from blood, bodies, hair follicles, and sometimes even skin cells left over. We can compare the DNA from different people to see if it is the same. If the bands are the same, the people are the same.

  9. Can you tell which of the two original samples of DNA are from the same person?

  10. So... We can use this to catch criminals. OR We can use it for paternity tests...

  11. In paternity testing we need to compare the child's DNA to the mothers DNA and then the possible fathers DNA.

  12. Is it possible that the men here are the real fathers of these children?

More Related