Addressable Bacterial Conjugation

1. Addressable Bacterial Conjugation UC Berkeley iGEM 2006 Bryan Hernandez Matt Fleming Kaitlin A. Davis Jennifer Lu Samantha Liang Daniel Kluesing Will Bosworth Advisors: Professors Adam Arkin and Jay Keasling GSIs: Chris Anderson and John Dueber

2. Project Goal To establish specific cell-to-cell communication within a network of bacteria

3. ...and make a bacterial brain

4. Key 2 Lock 2 Lock 2 Key 1 Lock 1 Lock 1 Lock 1 Lock 2 Project Goal F R

5. Turning that into a brain F pool R pool Each cell can send a key or a lock

6. Turning that into a brain Key or lock transfer is activated or repressed Most transfer events: 2 keys 2 locks Mismatched lock and key Sometimes the lock and key do match R type F type

7. Implementation NEED: To transfer genetic information from one bacteria to another MEANS: Conjugation NEED: To specifically control who can read the message MEANS: Riboregulation NEED: A neural network MEANS: NAND gate Matt Fleming Jennifer Lu Samantha Liang Bryan Hernandez Kaitlin A. Davis Daniel Kluesing Will Bosworth

8. Conjugation Team

9. F F F Bacterial Conjugation • Certain bacterial plasmids are classified as having a “fertility factor” i.e. F+ • Cells that have a F+ plasmid can conjugate and transfer their DNA to other bacteria F Pilus Formation F+ F- F+

10. Relavent Information • Conjugative plasmids are very large, from 60k – 100k basepairs long • Many trans-acting genes are involved in the process • DNA transfer begins at a specific sequence on the plasmid, OriT, the Origin of Transfer.

11. Modification of conjugative plasmids • OriT is knocked out of the conjugative plasmid • OriT is restored on a second plasmid that carries the message • A tra gene necessary for conjugation is disrupted in the conjugative plasmid • The tra gene is restored in trans but locked by a riboregulator

12. Conjugation Assays TriR KanR TriR AmpR F/R plasmid (KanR) F/R plasmid (KanR) oriT (AmpR/colE1) oriT (AmpR/colE1) tra (CmR/colE1) Genome (TriR) Donor-KanR/CmR/AmpR/TriS Recipient-KanS/CmS/AmpS/TriR

13. Status: RP4 • Mutation and complementation of oriT works fine • DtraJ-R is insufficient to fully destroy transfer ability ....need to knockout some other tra

14. Genetic Map of RP4 "trb" genes "tra" genes

15. Genetic map of tra1 region

16. Literature Survey of RP4 genetics 1) To what degree does the mutant disrupt conjugation 2) To what degree does complementation restore conjugation 3) Can complementation be done from multiple plasmids 4) Are there multiple examples of disruption/complementation

17. Ol, TlOl TlOl Status: F • oriT plasmids can be transferred by wt F in trans ...but not by the "Ol" isolate • PCR analysis of Ol oriT locus shows it is wildtype

18. Should our oriT mutant be dead? Fu-1991 Yes.

19. Literature Survey of F genetics • F plasmid transfer is leaky due to alternate mechanisms of transfer • trbC shows is the least leaky mutant identified

20. Riboregulator Team

21. The Riboregulator • Method of translational control of gene expression • cis-repressive sequence (“lock”) upstream of a gene’s coding region forms a hairpin, sequestering the ribosome binding site • trans-activating (“key”) mRNA strand binds and opens the hairpin thus allowing access to the RBS. • Highly specific activation occurs. Very similar lock and key pair sequences do not exhibit crosstalk Isaacs et al., Nature Biotechnology, 2004

22. Biobricked Riboregulator taR12 key crR12 lock Key 1 Lock 1 RBS region Biobrick Mixed Site Address Region Hairpin loop Start of locked gene

23. Results with lock3/key3 Strain Fluorescence no plasmids 31 lock3RFP 44 key3 + lock3RFP 78 OnRFP 6415 key3 + lock3-RFP

24. Improved locks and keys Presence of hairpin Position of promoter Degree of homology Position of terminator Transcriptional fusion Length of spacer Distance from RBS

25. Key3b and key3c key3 3 point mutations off duplex key3b Perfect duplex, No hairpin Strain Fluorescence no plasmids 336 lock3RFP 451 +key3 1181 +key3c 1103 +key3b 332 key3c Perfect duplex

26. Improved locks and keys Presence of hairpin Position of promoter Degree of homology Position of terminator Transcriptional fusion Length of spacer Distance from RBS

27. Alternate hairpin structures key3d

28. BioBricks gaattcgcggccgcatctagagtactagtagcggccgctgcag EcoRI XbaI SpeI PstI

29. gaattcgcggccgcatctagagtactagtagcggccgctgcag cttaagcgccggcgtagatctcatgatcatcgccggcgacgtc Digest ctagtagcggccgctgcag atcgccggcgacgtc gaattcgcggccgcat cttaagcgccggcgtagatc Ligate gaattcgcggccgcatctagtagcggccgctgcag cttaagcgccggcgtagatcatcgccggcgacgtc

30. XbaI SpeI PstI EcoRI XbaI SpeI PstI EcoRI

31. XbaI SpeI PstI EcoRI XbaI SpeI PstI EcoRI XbaI SpeI PstI EcoRI

32. XbaI SpeI PstI EcoRI XbaI SpeI PstI EcoRI

33. XbaI SpeI PstI EcoRI XbaI SpeI PstI EcoRI XbaI SpeI PstI EcoRI

34. Biobrick plasmids: other origins p15A/CmR Biobrick pSB3C6

35. Functional suffixes and prefixes E-Ptet-X-SP pJ23006 E-Ptet-rbs-X-SP EX-S-rbsRFP-P

36. Suffix and prefix stuffers pSB1A2-b0015 pSB1A??-b0015

37. NAND Team

38. key key TetR lock lock tetR tetR Conjugative NAND Gate tra key lock tra + + - + - + - + + - - +

39. key luxI lock Plux tetR GFP Conjugative NAND Gate luxI luxR GFP + + + + - - - + - - - - luxR

40. The Wiki http://www.openwetware.org/wiki/IGEM:UC_Berkeley/2006

41. Acknowledgements iGEM-2005 team Jonathan Goler MIT folks: Randy Rettberg Reshma Shetty Melissa Li Keasling Lab Arkin Lab Microsoft for funding