1 / 39

DNA, RNA and Proteins

DNA, RNA and Proteins. Ms. Hughes. DNA Genetic Material. Mendel showed that traits are passed from parent to offspring. Instructions for how genes are inherited. Genes are made up of segments of DNA: Deoxyribonucleic acid.

lobo
Download Presentation

DNA, RNA and Proteins

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA, RNA and Proteins Ms. Hughes

  2. DNA Genetic Material • Mendel showed that traits are passed from parent to offspring. • Instructions for how genes are inherited. • Genes are made up of segments of DNA: Deoxyribonucleic acid. • DNA is the primary material that causes recognizable, inheritable characteristics in related groups of organisms.

  3. Genetic Material • DNA is composed of four nucleotide subunits: • Each nucleotide has the same five carbon sugar molecule and phosphate group but different nitrogenous bases: • Adenine • Guanine • Cytosine • Thymine

  4. Shape of DNA • Winding stair case – 1 • Parts of the nucleotide subunits – 2 • 1’s find another 1 and compare notes! • 2’s find another 2 and compare notes!

  5. If you are a 1 find a 2 • If you are a 2 find a 1 • Share your information but DO NOT COPY!!! • You must explain it to your partner!!!

  6. Information in DNA • Pyrimidines: Thymine and Cytosine • Purines: Adenine and Guanine • DNA is in the shape of a spiral stair case/ double helix of two complementary strands of nucleotides.

  7. Base Pairing Rule • A always binds with T • G always binds with C • So A=T and G=C • Purine always binds to pyrimidine • Watson, Franklin and Crick discovered 3D model .

  8. Chargaff’s observation • A = T • G = C • Base pair rule

  9. Activity • Read and summarize watson and cricks model of DNA. • K,W,L • Knew • Would like to learn more about • Learned

  10. Activity/homework • Draw, label and explain a strand of DNA including the nucleotide subunits, base pairing and complimentarity of the strands.

  11. DNA Replication • DNA replication: the process of making a copy of DNA. • In DNA replication, the DNA molecule unwinds, and the two sides split. Then new nucleotides are added to each side until two identical sequences result. DNA replication occurs before a cell divides so that each cell has a complete copy of DNA. The basic steps of DNA are:

  12. Video • DNA replication McGraw Hill • http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120076/micro04.swf::DNA%20Replication%20Fork

  13. Unwinding and Separating DNA Strands • The double helix unwinds. • Complementary strands of DNA separate from each other and form Y shapes areas are called replication forks.

  14. Adding Complementary Bases • At the replication fork, new nucleotides are added to each side and new base pairs are formed according to the base pairing rules. • The original two strands serve as a template for two new strands.

  15. Formation of Two Identical DNA Molecules • DNA replication produces two identical DNA molecules

  16. Replication Proteins • During the replication of DNA, many proteins form a machinelike complex of moving parts.

  17. DNA Helicase • DNA helicases unwind the DNA double helix during DNA replication. • This process causes the helix to unwind and forms a replication fork.

  18. DNA Polymerase • Proteins called DNA polymerases catalyze the formation of the DNA molecule. • The polymerases add nucleotides that pair with each base to form two new double helixes. • DNA polymerases also have a “proofreading” function. During DNA replication, errors sometimes occur, and the wrong nucleotide is added to the new strand. DNA polymerase cannot add another nucleotide unless the previous nucleotide is correctly paired.

  19. Prokaryotic and Eukaryotic • In prokaryotic cells, replication starts at a single site. In eukaryotic cells, replication starts at many sites along the chromosome.

  20. Prokaryotic DNA Replication • Prokaryotic cells usually have a single DNA molecule, or chromosomes. Prokaryotic chromosomes are a closed loop, may contain protein, and are attached to the inner cell membrane.

  21. Eukaryotic DNA Replication • While prokaryotes have a single chromosome/loop, eukaryotic cells often have several chromosomes. • By starting DNA replication at many sites along the chromosome they can replicate their DNA faster than prokaryotes, two distinct replication forks form at each start site, and replication occurs in opposite directions.

  22. Activity: DNA replication • Eukaryotic vs. Prokaryotic

  23. Activity • Create a comic strip explaining DNA replication of a eukaryotic organism using all proteins and correct terminology.

  24. RNA and Gene Replication • Proteins perform most of the functions of cells. DNA provides the original “recipe”. • RNA: ribonucleic acid allows genetic information to be taken from DNA and proteins be made. • Gene expression: the manifestation of genes into specific traits.

  25. Transcription: DNA to RNA • The first stage of gene expression. • RNA is making proteins from the information found in DNA.

  26. Translation: RNA to Proteins • Second stage of gene expression. • Information form RNA is used to make specific proteins.

  27. RNA: Major Player • In cells three types of RNA complement DNA and translate the genetic code into proteins. • RNA vs. DNA • Both have four bases and carry genetic information. • RNA is composed of one strand of nucleotides and DNA is composed of two strands of nucleotides. • RNA substitutes Uracil for Thymine.

  28. 1, 2, 3 • 1 – messenger RNA • 2 – transfer RNA • 3 – ribosomal RNA • 1 share with other 1’s • Then 1, 2, 3

  29. Types of RNA • Messenger RNA: carries instructions for a gene to the site of translation. • Transfer RNA: reads the messenger mRNA sequence. • Ribosomal RNA: found in ribosomes, transports proteins from the ER as they are produced.

  30. Transcription: Reading the Gene • During transcription , the information in a specific region of DNA is transcribed, or copied into RNA. • Step 1: RNA polymerase binds to the promoter ( a specific DNA sequence/start location). • Step 2: RNA polymerase unwinds the dbl helix to expose both paired nucleotide bases. • Step 3: RNA polymerase links and binds complementary base units to each strand of DNA. • The result once the stop codon is reached is one strand of mRNA is produced.

  31. Transcription vs. Replication • Both use DNA as a template. • Transcription – mRNA is made, using portions of each strand of DNA • Translation – DNA is made, using both entire strands of DNA.

  32. Transcribe and then translate this sequence: • A T C G G C G GG A T TT A T T C CC G

  33. Transcribe and then translate this sequence: • ATCGGCGGGATTTATTCCCG

  34. Homework • Create a comic strip for the steps of transcription and translation of a eukaryotic organism.

  35. Genetic Code: 3 letter “words” • Each 3 nucleotide sequence is called a codon. • Each codon unit codes for a specific amino acid. • Turn to page 307 and look at the amino acids that are possible there are 20.

  36. Translation: RNA to proteins • Translation occurs in a sequence of steps, involves three kinds of RNA and results in a complete polypeptide.

  37. Complexities of Gene Expression • The relationship of gene expression is complex. • Despite the neatness of the genetic code, every gene cannot be simply linked to a single outcome.

  38. Transcribe and then translate this sequence: • ATC GGC GGG ATT TAT TCC CG • Now use the codon chart to determine which amino acids this codes for.

More Related