1 / 56

Advances in Genomics Since the Publication of the Human Genome

Advances in Genomics Since the Publication of the Human Genome. Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield, ME Contributing editor, Journal of the American Medical Association. Disclosures.

lora
Download Presentation

Advances in Genomics Since the Publication of the Human Genome

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Advances in Genomics Since the Publication of the Human Genome Greg Feero, M.D., Ph.D. Faculty, Maine-Dartmouth Family Practice Residency Program, Fairfield, ME Contributing editor, Journal of the American Medical Association

  2. Disclosures • No financial or intellectual conflicts of interest. • I am a primary care doctor. • For better or worse, my opinions are my own!!

  3. Outline • Still waiting for the revolution? • Discovery apace. • An unsatisfying answer? • The final word – education!

  4. Science 4 Feb 2011

  5. Impact of genomics Degree of specialization

  6. February 2011 NHGRI Published New Vision for Genomics

  7. Genomic Accomplishments: Base Pairs to Bedside Understanding the Structure of Genomes Understanding the Biology of Genomes Understanding the Biology of Disease Advancing the Science of Medicine Improving the Effectiveness of Healthcare 1990-2003 Human Genome Project 2004-2010 2011-2020 Beyond 2020

  8. Sequence from chromosome 7 GAAATAATTAATGTTTTCCTTCCTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATTATTATTTTTTGAGACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCTGGTTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTGGCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTCCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCATCAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAAAAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACATATCTCTTCGTGATTGCATTCTGATCCCCAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCTCAGAAAAATGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATGTATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAAAATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTGTAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATCTCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCATTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAGTTTATCAACTAGTTCATTTTTAAAAGTCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCCAGATCCAGCATAGGGTATGTTTGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGAGAAAGCTGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTTTTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATGAGTAATTAATATCTGTTATATAATATTCATTTTCATAGTGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGGGAAAGAAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACTATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGGTAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATAGTCACACTGAACTATATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCAATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGAAACAAACTGAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATCCTGGAAAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAA About 2000 bases

  9. Only about 3,000,000 more slides to go.

  10. At one slide per second, this lecture will be done in about 35 days!

  11. The human genome is pretty darn big.

  12. “The race was to sequence the human genome, all 3 billion genetic letters of it… a race not to the finish but to the starting line. Moreover, … the new race marked by that starting line was a marathon.”

  13. Circa 2000

  14. Circa 2012

  15. Genomic Accomplishments: Base Pairs to Bedside Understanding the Structure of Genomes Understanding the Biology of Genomes Understanding the Biology of Disease Advancing the Science of Medicine Improving the Effectiveness of Healthcare 1990-2003 Human Genome Project 2004-2010 2011-2020 Beyond 2020

  16. Progress in Mendelian disease gene discovery 1990 2011 Known Unknown, suspected Mendelian Sources: Lander, E. Nature , Feb. 2011 www.genetests.org, Feb 2011

  17. Cystic fibrosis Adult onset diabetes AIDS

  18. SNP A SNP B Diabetes Diabetes Unaffected Unaffected

  19. Continued Progress in Genotyping Technology Affymetrix 500K Illumina 550K Illumina 650Y Illumina 317K Cost per person (USD) July 2005 Oct 2006 Courtesy S. Gabriel, Broad/MIT

  20. NHGRI Catalog of Published Genome-Wide Association Studies (GWAS) > 5619 SNPs!!

  21. Equation of a Variant’s Predictive Potential = X Association Strength Predictive Potential Effect size

  22. Classical genetic study“mutation” = X Association Strength Predictive Potential Effect size Association => Causality

  23. Genome Wide Association Study“SNP” = X Association Strength Predictive Potential Effect size

  24. Genome Wide Association Study“SNPs” = X ? Association Strength Predictive Potential Effect size

  25. Quantum Leaps in Technology: .….Genome sequencing at $1000 or less for a mammalian genome….. Nature, April 2003

  26. Advances in Genome Biology and Technology Conference February 2012

  27. genome.gov/sequencingcosts

  28. Sequencing ?? ? = X Association Strength Predictive Potential Effect size

  29. Frequency vs. Effect ? Classical mutation Effect size SNP-like variation Frequency in population

  30. Published online April 2, 2012

  31. Nature 9/23/12

  32. 30 JUNE 2011

  33. 16 June 2011

  34. You are not alone in there….

  35. Quality Health Care Genomics Personalized Medicine

  36. JAMA, March 14,2012

  37. Solutions – primary care style… • 33% of diabetics are undiagnosed --- blood glucose. (Almanac, 2008) • 24%of hypertensives undiagnosed --- blood pressure measurements. (Almanac, 2008) • 37% of high cholesterol undiagnosed --- fasting lipid panel. (Almanac, 2008) • Universal health care, better screening programs, smoking cessation, exercise programs, improved nutrition etc…

  38. WSJ, Nov. 2, 2013 $1,600,000!!!!!!

  39. Are the expenses of targeted treatments sustainable?For:Patients?Insurers?State budgets?National economies?

  40. EBM PM

More Related