1 / 43

Interactions with Hosts and Pathogens -a history of close calls-

Interactions with Hosts and Pathogens -a history of close calls-. Clint Magill Professor of Genetics Department of Plant Pathology & Microbiology Texas A&M University. 4N maize X 4N sorghum . ‘Rescued’ embryos. Pathogen Variability. Anthracnose of Sorghum. 18 isolates. 17 pathotypes.

lorna
Download Presentation

Interactions with Hosts and Pathogens -a history of close calls-

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Interactions with Hosts and Pathogens-a history of close calls- Clint Magill Professor of Genetics Department of Plant Pathology & Microbiology Texas A&M University

  2. 4N maize X 4N sorghum • ‘Rescued’ embryos

  3. Pathogen Variability Anthracnose of Sorghum 18 isolates 17 pathotypes Louis Prom & RamasamyPerumal

  4. Rice Blast

  5. Complementing di-auxotrophsPyriculariaoryzae leu-, ade- lys-, met- nic-, ura- buf, lys- Dennis Genovesi

  6. 1N and 2N conidia Parasexual origin of new pathotypes?

  7. Anther Culture and Rice Chloroplast DNA ChantelScheuring

  8. Aberrant Ct DNA in Albinos Green Albino Albino Green Alberto Livore

  9. Texmont Rice

  10. Pathogenic Race Changes BaiChai Wu

  11. Stable M. grisea Strain

  12. Unstable M. grisea Strain

  13. Phymatotrichumomnivorum grapes Cotton root rot fruit trees (pear)

  14. DNA methylation in P. omnivorum P. omnivorumgrew in 5AZA C; the sclerotia that formed had no 5mC and did not germinate Jane Magill, Eldon Jupe

  15. Pathogen-induced host defense -mRNA Oscar Joost, Al Bell, Bob Stipanovic

  16. CVVK CVVK HMGR CoA-reductase (first step in terpenoidphytoalexin synthesis)

  17. Chan Benedict, Jingao Liu

  18. - gossypol

  19. Gail Martin

  20. Sorghum Defense Responses (PAL is the first step in flavonoid phytoalexin biosynthesis) Cory Cui

  21. Head Smut; Sphacelothecareiliana

  22. Stealth pathogen- no response

  23. Grain mold/Curvularia & Fusarium Chris Little, SeribaKatilé

  24. AFP mRNA levels in sorghum glumes 48 h post inoculation withCurvularia lunata (CL), Fusarium thapsinum (FT), water (control) or both CL+FT. RTx430SC170SurenoTX2911

  25. RTx430SC170SurenoTX2911 PR10 mRNA levels in glumes 48h p.i.

  26. P. sorghi • conidia-asexual spores • antheridum and oogonium forming in leaf tissue

  27. Downy mildews of Andropogonea • Peronosclerospora sorghi • P. maydis • P. sacchari • P. philippinensis(select agent) • P. zeae • Sclerophthorarayssiae(select agent) • Sclerospora graminicola

  28. Dot-Blot Hybridizations; probe pMLY12 Colletotrichm graminicola P. sorghi Infected seed, with glume Acremonium strictum Healthy seed, with glume Fusarium moniliforme Infected seed, no glume Infected seed, glumes 40d Healthy seed, no glume Infected seed, no glumes 40d Chenglin Yao

  29. P. sorghi Thai1 P. sorghi Thai2 P. sorghi Thai1 P. sorghi Thai2 P. sorghi pt1 P. sorghi pt1 P. sacchari P. sacchari P. maydis P. maydis M M ITS 1 ITS 2 & 5.8s PCR using conserved ITS primers

  30. Nebulize genomic DNA with HaeIII, RsaI, and DraI+ 50 ng of RNaseA 2. Ligate adapters AP11 (5´CTCTTGCTTAGATCTGGACTA3´) & AP12 (5´pTAGTCCAGATCTAAGCAAGAGCACA3´, where p = 5´ phosphate) 3. Amplify by PCR using AP11 primer 9.Cloning, Squencing, Identifying SSRs, Primer Designing & Pathotypes genotyping Microsatellite Capture SSR’s for DM 4. Hybridize with di & tri biotinylated oligos (TG/AC, CA/GT, GA/CT, CAA, AGG and GTT) 8. Amplify by PCR using AP11 primer 6. Elution Of captured DNA 5.Select with streptavidin-coated paramagnetic beads 7. Remove residual oligos

  31. Cluster analysis of DM species based on 54 Simple Sequence Repeats RamasamyPerumal

  32. R gene tagging Sorghum anthracnose example Midrib infection Stem infection Seed infection

  33. Co-segregation of AFLP marker Xtxa6227 and the Cg1 locus in F2-3 progeny derived from the cross of BTx623 and SC748-5. AFLP templates from parental inbreds BTx623 (cg1cg1) and SC748-5 (Cg1Cg1) and IS3620C (mapping parent) were run as controls to aid in the identification of polymorphic bands. Co-segregation of dominant SSR marker SSR 1 and the cgf1 locus in F2-3 progeny derived from the cross of ATx623 and SC748-5. Genomic DNA from parental inbreds BTx623 (cg1cg1) and SC748-5 (Cg1Cg1) were run to aid in the identification of parental alleles for SSR 1. The amplified band from the SSR 1allele was 152 bp (BTx623) or 155 bp (SC748-5) RamasamyPerumal

  34. Jae Min Cho and Andy Paterson

  35. Sorghum RGA Map

  36. Claviceps africana: Ergot

  37. RNAi against cotton nematodes Root-Knot reniform

  38. Two species causing large losses in Texas • Root knot = Meloidogyne incognita • Reniform = Rotylenchulusreniformis • Plan • ID ‘matching’ sequences in genes of both species that are lethal if knocked out in C. elegans • Prepare hairpin construct to express in cotton • a) roots • b) constitutively (CaMV 35S promoter) • So far • No common sequences, but individual constructs made • Transient expression in root cultures worked well • Transgenic plants look very promising KeertiRathore and Jim Starr

  39. THANKS To you for listening and to TRRF Several USDA Collaborative Agreements INTSORMIL TARP The Sorghum Checkoff Program Global Crop Diversity Trust Texas A&M Agrilife Research (formerly TAES) For Research $$

More Related