E N D
Abstract Little is known about the reproductive habits of paddlefish, a threatened species in Wisconsin and Minnesota. Biologists studying paddlefish spawning grounds find it difficult to differentiate between the eggs of paddlefish and sturgeon based upon appearance alone. Both species are also threatened by poaching, with their eggs sold as caviar. A PCR based test has been developed to amplify a portion of the cytochrome B gene from a single paddlefish or sturgeon egg. The presence of distinct HincII restriction sites in the paddlefish and shovelnose sturgeon PCR products allows for the rapid determination of whether a single egg came from a paddlefish, shovelnose sturgeon or lake sturgeon. These tests will eventually allow fisheries biologists to better monitor and protect paddlefish spawning habitats. This test may also have forensic applications.
Sample Preparation • Eggs kept on ice until freezing at -80oC • Single egg mashed with sterile glass rod in 200 ul buffer (20 mM Tris, 20 mM KCl, 0.5% Tween 20, 5% Chelex, 0.2 mg/ml proteinase K) • Samples incubated 1.5 hours at 55oC • Samples incubated 8 minutes at 95oC • Samples centrifuged at 14,000 rpm for 10 minutes • An aliquot was removed for PCR amplification (1 ul)
5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ Polymerase Chain Reaction (PCR) CBR1 Mix together... • Sample DNA • dNTPs • Buffer • Taq DNA Polymerase • PCR Primers CBL1 TGATGAAATTTTGGCTCACT CBR1 GTGGAAGGCGAAGAATCG CBL1 95oC 55oC 72oC
10 u1 1 ul 0.1 ul 0.01 ul 500 bp 5’ 400 bp 3’ 300 bp 220 bp 200 bp Sample size vs. PCR product After 30 cycles of amplification the primary DNA product will be the region found between the two primers. Figure 1. PCR product concentration is affected by the amount of DNA in the sample. Volumes represent ul of egg homogenate.
Cytochrome b DNA Sequences • PCR products from paddlefish, shovelnose sturgeon and lake sturgeon were cloned and sequenced. Table 1. Percent DNA Sequence Identity Shovelnose Lake 86.6% 86.0% Paddlefish Lake 90.8%
HincII PA SN LK NarI HincII Restriction Mapping Restriction enzymes cut DNA at specific sites. A single change the sequence of that site will prevent cleavage. Example: HincII cuts GTTAAC in paddlefish cyt b DNA but not GTAAAC in sturgeon cyt b DNA
Restriction Enzyme Digestion Mix together : • 1 ul PCR product • 8 ul buffer and water • 1 ul restriction enzyme Incubate 30 min, 37oC. Subject sample to agarose gel electrophoresis for 45 minutes. Stain gel with ethidium bromide and photograph.
PA uncut PA cut SN uncut SN cut LK uncut LK cut PS uncut PS cut Stds 500 bp 400 bp 300 bp 220 bp 200 bp Figure 3. Restriction digest of PCR products with the restriction enzyme HincII. Samples were run on a 3% Methaphor agarose gel.
PA uncut PA cut SN uncut SN cut LK uncut LK cut PS uncut PS cut Stds 500 bp 400 bp 300 bp 220 bp 200 bp Figure 4. Restriction digest of PCR products with the restriction enzyme NarI . Samples were run on a 1% LE agarose gel.
Conclusions • Enough DNA can be isolated from a single fish egg to allow for sucessful PCR amplification. • DNA sequence analysis demosnstrates unique genetic markers in paddlefish, shovelnose sturgeon and lake sturgeon. • This assay will allow the species identification of a single egg within one day. • To date this assay has been tested on more than ten fish, from all over the country, with no observed discrepancies in the assay.