1 / 5

A.F. Santos, D.M. Tebit , M.S. Lalonde , A. Ratcliff, M.A. Soares , E.J. Arts

Poster Discussion. Natural polymorphisms in the protease of HIV-1 isolates explain hypersusceptibility to protease inhibitors. A.F. Santos, D.M. Tebit , M.S. Lalonde , A. Ratcliff, M.A. Soares , E.J. Arts.

marli
Download Presentation

A.F. Santos, D.M. Tebit , M.S. Lalonde , A. Ratcliff, M.A. Soares , E.J. Arts

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Poster Discussion Natural polymorphisms in the protease of HIV-1 isolates explain hypersusceptibility to protease inhibitors A.F. Santos, D.M. Tebit, M.S. Lalonde, A. Ratcliff, M.A. Soares, E.J. Arts • Antiretroviral therapy is now a reality in developing countries, where several HIV-1 non-B subtypes predominate. However, there are scarce studies on drug susceptibility in such subtypes. • Our objective here was evaluate the influence of protease polymorphisms in CRF02_AG on drug susceptibility and fitness.

  2. Hypersusceptibility is defined when an isolate presents a higher susceptibility (at least 2.5 or more, or Fold-Change < or equal to 0.4) than subtype B wild type (HxB2 or NL43). • We obtained 149 HIV-1 isolates of treament-naive patientsfrom the Stanford HIV drug resistance database, which had been phenotyped by Antivirogram® assay (VIRCO, Belgium). * * * * HS Proportion * * p value ≤ 0.05

  3. Natural Polymorphisms conferring Hypersusceptibility

  4. Natural polymorphisms increase replicative capacity Oligonucleotide Ligation Assay (OLA) GTTACAGTAAAATTAGGGGGACAGCTGATAGAAGCCTTAT (BD6-15) C Tagged primer 17G Tagged universal primer GTTACAGTAAAATTAGGGGAACAGCTGATAGAAGCCTTAT (17E) T Tagged primer 17E Tagged universal primer Detection of competitors by double fluorescence Ligation reaction (140 cycles) Ranking: 17E/64M > 17E > 64M > BD6-15

  5. Conclusions • Some subtypes showed higher HS proportion than subtype B – the subtype for which drugs were designed; • The dual polymorphism 17E/64M increased greatly viral susceptibility to atazanavir, nelfinavir and saquinavir, while 70R alone causes HS to amprenavir and indinavir. This is the first study to showing that natural polymorphisms in viral protease present an inportant role in drug susceptibility to PIs; • The HS polymorphisms increased the viral fitness, suggesting that its presence increased the enzymatic processing. Additional studies are underway to test this hypothesis.

More Related