210 likes | 402 Views
http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm Understanding DNA : How Stuff Works. DNA BASE PAIRS. Genetic Variation : A Key to Survival. GENETIC VARIATION leads to Adapt ation. RESISTANT STRAIN.
E N D
http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htmhttp://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm Understanding DNA: How Stuff Works
GENETIC VARIATION leads to Adaptation
RESISTANT STRAIN How do malaria parasites survive anti-malaria medications?
How Do CellsReproduce? http://luigigalvani5.blogspot.com/2008/...ary.html http://waynesword.palomar.edu/lmexer2a.htm Different copy Identical copy
Mixing of Genes CROSSING OVER
MINI-LAB: Observing cell reproduction • Mount a prepared slide of a cell undergoing cell division. 2. Draw the cell and label the ff structures: a. cell membrane b. chromosomes 3. Describe what you see. • Note: Follow guidelines on • Making Diagrams • Accurate representation • 2-D diagram • Proper labels • Neatly presented
Crossing over: Why we are different from our parents VC; Where do genes come from
DNA COPIES ITSELF:Base pairings: A- T C – GDNA moleculeunzips breaking the base pairs forming 2 sides VC: DNA Replication
A: TACCGGATGCCAGATCAAATCWhat is the other side?__________________________ Given the code of a DNA molecule, what would be the code of the new DNA strand? B: TACGGGGGCGTAACCACAACTWhat is the other side?__________________________
VC: How DNA copies itself From DNA to protein
2.CODE IS READ. The code of the new strand (DNA copy) is READwith theT replaced with a new base Uracil or U. A: ____________________________________ B: ____________________________________
3. CODE IS TRANSLATED. The code is read in groups of 3 called codons). A: ____________________________________ B: ____________________________________
Find the Amino Acid sequence that is coded: Use the following guide. A: ____________________________________ B: ____________________________________
New copy (RNA) is read and translated Genes(DNA) Make copies of itself Crossover (mixing of code) www.squidoo.com/geneticsresearch Amino acids (protein) are formed A trait is expressed VC: What is phenotype
Cracking the Code DNA VC: Cracking the code copied and read RNA translated http://entomology.wisc.edu/~goodman/wgr...rch.html PROTEIN
While the copying of DNA is a very accurate process, what happens when a letter is altered? VC: DNA Mutation
A: TACCGGATGCCAGATCAAATCWhat is the other side? Given the code of a DNA molecule, what would be the code of the new DNA strand? AT_GCCTACGGTCTAGTTTAG B: TACGGGGGCGTAACCACAACTWhat is the other side?ATGCGCCCGCATTGGTGTTGA