1 / 34

Protein synthesis

Protein synthesis. http://cellbio.utmb.edu/cellbio/ribosome.htm. http://faculty.uca.edu/~johnc/mbi1440.htm. DNA vs RNA. http://www.algosobre.com.br/biologia/dna-e-rna.html. Types of RNA. Messenger RNA (mRNA): copy of DNA.

meghan
Download Presentation

Protein synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Protein synthesis http://cellbio.utmb.edu/cellbio/ribosome.htm

  2. http://faculty.uca.edu/~johnc/mbi1440.htm DNA vs RNA

  3. http://www.algosobre.com.br/biologia/dna-e-rna.html

  4. Types of RNA Messenger RNA (mRNA): copy of DNA http://www.ncbi.nlm.nih.gov/Class/MLACourse/Modules/MolBioReview/transcription.html

  5. Types of RNA • Transfer RNA (tRNA):

  6. Types of RNA http://www.chm.bris.ac.uk/motm/linezolid/linezolid.htm http://www.molecularassembler.com/KSRM/ListFigures.htm

  7. http://www.langara.bc.ca/biology/mario/Biol2315notes/biol2315chap11.htmlhttp://www.langara.bc.ca/biology/mario/Biol2315notes/biol2315chap11.html

  8. Genetic code • 20 a.a. • But only 4 RNA bases… • If 2 nucleotides, only 16 a.a. (42 = 16) • 3 nucleotides is great 43 = 64

  9. http://www.cbs.dtu.dk/staff/dave/roanoke/genetics980320f.htm

  10. Exercices together • Transcribe this DNA into mRNA: • ACGGTATTACCGCTA • UGCCAUAAUGGCGAU (Answer) • Now translate this mRNA into a protein: • AUGCAUUGUAUGGGUUAAGCG • Met, His, Cys, Met, Gly (stop)

  11. Transcription • Initiation: • 1) RNA polymerase binds to DNA at a promoter region • 2) DNA unwounded and template strand exposed

  12. Transcription • Elongation: • 1) mRNA synthesized in 5’ to 3’ using template strand • 2) elongation continues and DNA already transcribed rewinds into double-helix

  13. Transcription • Termination: • RNA synthesis stops; mRNA and RNA polymerase are released

  14. http://www.dadamo.com/wiki/wiki.pl/Transcription_(DNA_transcription)

  15. Check your understanding • Biology12 Textbook • P. 241 # 1, 3-6, 8-11, 13 and 14

  16. Posttranscriptional modifications • In eucaryotic cells • 5’ cap is added to the start. It’s a 7-methyl guanosine which protects the mRNA from digestion by nucleases and phospohotases. See p. 244 fig. 3 • Poly-A tail is added by poly-A polymerase to the 3’end. It’s to protect and helps initiate translation.

  17. Posttranscriptional modifications • Introns are removed by spliceosomes. http://faculty.uca.edu/~johnc/rnaprot1440.htm

  18. Check your understanding • Biology12 Textbook • P.249 # 1-5, 7-12

  19. Translation: Initiation

  20. Translation: Elongation About 60 ms/peptide bond!

  21. Translation: Termination

  22. Animation of the whole protein synthesis: http://207.207.4.198/pub/flash/26/transmenu_s.swf

  23. Check your understanding • Bio 12 p.254 # 1-4, 6, 7 and 9 • Do Activity 5.4.1 p.269-270

  24. Point mutation : Substitution of one base

  25. Point Mutation : missense and nonsense Silent mutation:

  26. Point mutation: insertion and deletion mutation

  27. Check your understanding • Bio 12 p. 263 # 1, 6-8

  28. Control Mechanisms • 42 000 genes in humans! • Housekeeping genes : always needed in a cell • Transcription factors turn genes on when required

  29. 4 levels of control of gene expression • Transcriptional: controls which genes are transcribed or rate of transcription • Posttranscriptional: controls posttranscription • Translational: controls how often and how fast translation happens • Posttranslational: Controls passage through membrane and rate of activation of proteins and time its remains functional.

  30. Operon control • Operon: cluster of genes under the control of one promoter and one operator in prokaryotic cells • Operator: regulatory sequences of DNA to which a repressor protein binds

  31. The lac operon http://fig.cox.miami.edu/~cmallery/150/gene/operon.htm

  32. The trp operon http://fig.cox.miami.edu/~cmallery/150/gene/feedback.htm

  33. Check your understanding • Bio12 p. 258 # 1 – 6.

More Related