Differential Sperm Cell Gene Expression in Plumbago

1. Differential Sperm Cell Gene Expression in Plumbago RT-PCR. Three clones, A7, A12 and C8, were selected for RT-PCR detection. Different cycles were used. A7 expression can be detected at 18 cycles in the Sua, but at least 24 cycles are required in the Svn (Fig. 6). The A7 gene has a higher expression level in the Sua. The full-length cDNA of A7 was isolated by screening Sua cDNA library (Fig. 5). Sequencing showed that A7 codes a protein with 63 amino acids which is homologous to members of an arabinogalactan protein family in Arabidopsis (Fig. 7). This protein has a signal peptide and a transmembrane domain. Although the precise function of this gene family is unknown, they may play important roles in diverse developmental processes such as differentiation, cell-cell recognition, embryogenesis and programmed cell death15. Introduction Double fertilization in flowering plants involves two sperm cells: one fuses with the egg cell to form the zygote, whereas the other fuses with the central cell to form the endosperm. Plumbago zeylanica is a model system in which it is possible to identify the sperm cells. One sperm cell (Svn) is associated with the pollen vegetative nucleus, and the other unassociated sperm cell (Sua) is linked with the Svn. Functionally, the Sua fuses with the egg preferentially over 95% of the time1. The molecular control of this phenomenon is unknown, as gene expression in flowering sperm cells is still in its infancy. The first ESTs of genes expressed in sperm cells were released in GenBank in 2000 by Fang Chen’s laboratory and in 2002 by Sheila McCormick’s laboratory. Sperm-specific expression of GFP has recently been demonstrated (http://www.pgec.usda.gov/McCormick/McCormick/mclab.html) in Arabidopsis. The greatest success thus far has been obtained using generative cells, which are the immediate precursors to sperm cells. Work on cells of the male germ linage was impeded by problems in obtaining sufficient sperm cells to conduct molecular biology and in maintaining their purity during isolation from the pollen2. At that time, the accepted paradigm was that the male cells were too small and dependent to have an independent genetic program, but once protein, RNA and DNA synthesis were demonstrated in sperm3 and generative cells4, work on molecular biology began. Since then, male gamete expression of DNA repair genes5, substitution histones6, and essential sperm specific gene products7 have been demonstrated. The male gametic-specific expressed gene LGC1, isolated from lily generative cells7, is expressed in both generative and sperm cells, its gene product is distributed on the generative cell surface, and its expression is controlled by a sperm specific promoter. We are interested in the control of structural/functional sperm dimorphism, as expressed in Plumbagozeylanica, in which the pair of sperm cells undergo a developmental divergence in their organization and gene expression during pollen maturation, which affects their fate during fertilization. The divergence in sperm cells is marked by structural polarization, which is related to the position of the pollen vegetative nucleus and demonstrated most easily by differences in organelle content. The Svn typically contains many mitochondria and few or no plastids, whereas the Sua contains few mitochondria and abundant plastids; the latter usually fusing with the egg cell1. We are interested in how the differential fate of these two sperm cells is controlled. Recent research has shown that a male germ line-specific ubiquitin gene is highly up-regulated in both lily generative cells and in the Svn sperm cell of Plumbago8. In this study, we are interested in genes that are exclusively expressed or up-regulated in only one of the two sperm cells of Plumbago, especially genes involved in gamete cell recognition. Here we report preliminary results obtained by combining suppression subtractive hybridization and microarray analysis. Xiaoping Gou1, Tong Yuan1, Mohan B. Singh2, Scott D. Russell1 1Department of Botany and Microbiology, University of Oklahoma, Norman, OK 73019 USA 2Plant Molecular & Biotechnology Center, University of Melbourne, Parkville, Victoria 3052, AUSTRALIA Abstract Mature pollen of Plumbago zeylanica contain dimorphic sperm cells of two types: Sua and Svn. These cells contain different organelle complements and fuse with different female target cells, the Sua fusing with the egg cell and the Svn fusing with the central cell, respectively. To discriminate between genes active in each cell, we constructed subtracted cDNA libraries to each of these two kinds of sperm cells for microarray screening. PCR amplified products were cloned into pCR2.1-TOPO vector. The inserts were PCR amplified and spotted onto glass slides for microarray screening. 2304 clones of each subtracted cDNA library were examined using subtracted and unsubtracted cDNA probes. Subtractive hybridization made it easier to identify those genes expressed differentially in these two kinds of sperm cells. Several hundred clones that have different expression level in a pair of sperm cells have been identified. The expression pattern of seven clones has been verified by virtual northern hybridization and (or) RT-PCR. One of them, clone A7, which is homologous with arabinogalactan protein in Arabidopsis, has a signal peptide sequence and a transmembrane domain. It may play a role in cell recognition. Fig. 6.RT-PCR detection of A7, A12, C8 in Sua and Svn. Different cycles are showed on the top of the gel. H3.3 is a highly expressed control. Results cDNA synthesis of sperm cells. Because sperm cells are small and embedded in pollen, only limited quantities of sperm cells are available for this research. Therefore, mRNA needs to be reverse transcribed and PCR amplified. To assure that cDNA libraries are representative, PCR reactions need to be controlled carefully. For cDNA library construction, 11,428 Sua sperm cells and 11,073 Svn sperm cells were used. The corresponding PCR cycles were optimized at 24 and 26 cycles, respectively. For subtractive hybridization, 12,200 Sua sperm cells and 12,245 Svn sperm cells were used. The corresponding PCR cycles were optimized at 20 cycles (Fig. 1). Fig. 3. Microarray. Inserts of suppression subtractive hybridization clones were PCR amplified and spotted on glass slides. In each block, clones in the top four rows are putative Sua-expressed genes; the next four rows are putative Svn-expressed genes. The left slide was hybridized with subtracted probes; the right slide was hybridized with unsubtracted probes. The Sua probe was labeled with Cy3 (green), whereas the Svn probe was labeled with Cy5 (red). Fig. 7. A7, named as PzAGP, is homologous with putative Arabidopsis arabinogalactan proteins AtAGP16 and AtAGP20. Conclusions These results clearly indicate the feasibility of using microarray analysis and suppression subtractive hybridization to screen candidates for Sua- and Svn-specific gene expression patterns. Although sufficient mRNA is not available for traditional testing, use of PCR amplification seems to be adequate for presence/absence screening. In the future, we are interested in sperm cell differentiation and gamete cell-cell recognition. We plan to confirm the expression profiles of Sua- or Svn-specific expressed genes by RT-PCR, virtual northern hybridization and in situ hybridization. Following this characterization, we plan to search for corresponding genes in Arabidopsis that may be useful for sperm cell labeling and tracing the double fertilization process. Sequence data will be used to identify putative surface-localized proteins that may mediate sperm-egg interactions. This work will serve as the basis of future research on the control of gene expression that establishes the identity of sperm cell types. Acknowledgements We thank Drs. Bruce A. Roe, Tyrrell Conway, Jia Li, Doris M Kupfer and Mary Beth Langer for their kind help. This research was supported by USDA NRICGP grant #99-35304-8097, GLC Research Professorship funds from the University of Oklahoma and private donations.  Fig. 1.Different cycles were used to optimize the PCR reaction of ds-cDNA synthesis of Sua. M, Molecular standards. 1, 18 cycles. 2, 21 cycles. 3, 24 cycles. 4, 27 cycles. 5, 30 cycles. 6, 33 cycles. 24 cycles were used in this reaction. Fig. 2. Inserts of randomly selected clones of subtracted cDNA libraries were PCR amplified and separated on 1% agarose gel.  Table 1. Number of up-regulated expression clones using different probes Suppression subtractive hybridization. Subtractive hybridization is a powerful technique for comparing mRNA populations and selecting differentially expressed genes. Traditional subtractive methods are not suitable, as the amount of available mRNA is limited for flowering plant sperm cells. Therefore, the Clontech PCR-Select cDNA subtraction method was used to amplify differentially expressed sequences10. Sua- and Svn-specific expressed sequences were obtained by using subtractive hybridization, with one sperm cell source as ‘tester’ and the other as ‘driver’. In cases where different cell sources have strongly overlapping gene expression or where few mRNA species differ, this technique may produce significant numbers of false positives. The Sua and Svn, as cellular siblings, are thus likely candidates for additional screening. Microarray screening of cell products is an ideal screen prior to time-consuming northern hybridization. Microarray screening. After subtractive hybridization, PCR products were purified and cloned into pCR2.1-TOPO vector by T/A cloning and transformed into TOP10F’ competent cells. Inserts of recombinants were amplified by PCR. Most of the recombinants had inserts whose size ranged from 200 bp to 1.5 kb (Fig. 2). A total of 4,608 clones were selected for the following microarray analysis. Clones corresponding to differentially expressed genes will hybridize only with the tester probe. But it will be difficult to detect low-abundance differentially expressed mRNAs by traditional subtractive hybridization11,12. This problem can be bypassed by using subtracted cDNA probes to hybridize with the subtracted libraries. In this work, subtracted probes were synthesized by using Sua and Svn as tester or driver respectively. Since insufficient mRNA was available, probe was reverse transcribed, PCR-enhanced and labeled using Cy3 or Cy5. Combining suppression subtractive hybridization and microarray analysis techniques facilitates high throughput screening for differentially express-ed genes in sperm cells of Plumbago. Most of the clones of subtracted cDNA libraries represent differentially expressed Sua or Svn genes (Fig. 3). When hybridized with subtracted probes, the signal is stronger than that of unsubtracted probes and some low abundance, differentially expressed sequences can be detected13,14. After analysis by GenePix Pro 3.0, those clones with more than a 3-fold expression difference between the Sua and Svn can be identified easily with unsubtracted probes. Usually these clones represent abundant Sua or Svn specific genes. Hybridization with subtracted probes will help us to identify those low-abundance and rare messages expressed in Sua or Svn (Table 1). Virtual northern hybridization. To confirm expression specificity, six Sua-specific candidates and one Svn-specific candidate were selected and digoxigenin labeled. Labeled probes were hybridized with 0.5 µg Sua and Svn cDNA. All of them were confirmed as Sua- or Svn-specifically expressed genes. Four clones (A1, A12, B9, F4) have more than 1 gene family member. These clones were sequenced and compared with the data in GenBank by BlastX. The results are summarized in Table 2. Materials and methods Sperm cell isolation Sua and Svn sperm cells were isolated and collected in separate pools using a microinjector, as described in Zhang et al.9 Purified sperm cells were stored in liquid nitrogen until use. About 12,000 sperm cells were collected for each cDNA library and subtracted cDNA library. RNA isolation Total RNA of sperm cells was isolated by using Absolutely RNATM microprep kit (Stratagene) and precipitated by glycogen and ethanol. The RNA pellet was dissolved in 3 µl RNase-free water and immediately used for cDNA synthesis. cDNA library construction cDNA libraries were constructed using the Smart cDNA library construction kit (Clontech) according to the user manual. Suppression subtractive hybridization Double stranded cDNAs of Sua and Svn were synthesized using Smart PCR cDNA Synthesis kit (Clontech). Subtracted cDNA libraries were constructed using the PCR-Select cDNA Subtraction kit (Clontech). Subtracted cDNAs were purified and cloned into pCR2.1-TOPO vector (Invitrogen). Microarray experiments Clones of subtracted cDNA libraries were selected randomly and their inserts were PCR amplified. PCR products were purified by ethanol precipitation and dissolved in 50% DMSO. DNA samples were spotted onto CMT-GAPS coated glass slides (Corning) and air dried. Air-dried slides were rehydrated over boiling water and dried again on a 90℃ heating plate. Then slides were crosslinked in Stratagene Stratalinker UV Crosslinker. Slides were prehybridized for 1 hr and hybridized for 16 hr at 42℃ in hybridization chambers. Subtracted and unsubtracted cDNA of sperm cells were labeled by Cy3 and Cy5 dye (Amersham Phamacia). After washing, the signal was detected by Axon GenePix 4000A microarray scanner. Virtual Northern hybridization cDNA of sperm cells was synthesized by the Smart PCR cDNA synthesis kit. 0.5 µg dscDNA of Sua and Svn was separated respectively on 1% agarose gel and transferred to nylon membrane. Inserts of interesting clones were labeled by digoxigenin. Hybridization and signal detection were carried out according to the Roche non-radioactivity detection manual (Roche Applied Science). RT-PCR Equal amounts of cDNA of Sua and Svn were used for the RT-PCR reaction. The number of cycles was varied to demonstrate differential expression levels. • References • Russell, SD. 1985. Preferential fertilization in Plumbago: ultrastructural evidence for gamete-level recognition in an angiosperm. Proc Natl Acad Sci USA, 82:6129-6132 • Russell, SD. 1986. A method for the isolation of sperm cells in Plumbago zeylanica. Plant Physiology, 81: 317-319 • Zhang G, Gifford DJ, Cass DD. 1993. RNA and protein synthesis in sperm cells from Zea mays L. pollen. Sex Plant Reprod 6: 239-243 • Blomstedt CK, Knox RB, Singh MB (1996) Generative cells of Lilium longiflorum possess translatable mRNA and functional protein synthesis machinery. Plant Mol Biol 31:1083-1086 • Xu H, Swoboda I, Bhalla PL, Sijbers AM, Zhao C, Ong EK, Hoeijmakers JH, Singh MB (1998) Plant homologue of human excision repair gene ERCC1 points to conservation of DNA repair mechanisms. Plant J 13:823-829 • Xu H, Swoboda I, Bhalla PL, Singh MB. 1999a. Male gametic cell-specific expression of H2A and H3 histone genes. Plant Mol. Biol. 39:607–614 • Xu H, Swoboda I, Bhalla P L, and Singh M B. 1999b. Male gametic cell-specific gene expression in flowering plants. Proc Natl Acad Sci USA, 96: 2554-2558 • Singh MB, Xu H, Bhalla P, Zhang Z, Swoboda I, Russell SD. 2002. Developmental expression of polyubiquitin genes and distribution of ubiquitinated proteins in generative and sperm cells. Sexual Plant Reproduction 14: 325-329 • Zhang Z, Xu H, Singh MB, Russell SD. 1998. Isolation and collection of two populations of viable sperm cells from the pollen of P. zeylanica. Zygote 6: 295-298 • Diatchenko L, Lau YFC, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov ED & Siebert PD. 1996. Suppression subtractive hybridization: A method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc. Natl. Acad. Sci. USA 93:6025-6030 • Duguid JR & Dinauer MC 1990. Library subtraction of in vitro cDNA libraries to identify differentially expressed genes in scrapie infection. Nucl Acid Res 18:2789–2792 • Hara E, Kato T, Nakada S, Sekiya S & Oda K (1991) Subtractive cDNA cloning using oligo(dT)30-latex and PCR: isolation of cDNA clones specific to undifferentiated human embryonal carcinoma cells. Nucleic Acids Res. 19:7097–7104 • Welford SM, Gregg J, Chen E, Garrison D, Sorensen PH, Denny CT, and Nelson SF. 1998.Detection of differentially expressed genes in primary tumor tissues using representational differences analysis coupled to microarray hybridizationNucleic Acids Res 26: 3059-3065 • Yang GP, Ross DT, Kuang WW, Brown PO, and Weigel RJ. 1999. Combining SSH and cDNA microarrays for rapid identification of differentially expressed genes.Nucleic Acids Res 27: 1517-1523 • GasparY., Johnson K., McKenna J., BacicA, Schultz C. 2001.The complex structures of arabinogalactan-proteins and the journey towards understanding function. Plant Mol Biol 47: 161-176 Fig. 4. 0.5 µg SMART PCR amplified cDNA of Sua and Svn were separated on 1% agarose gel and transferred to nylon membrane. The blot was hybridized with DIG-labeled probes. Table 2.Differentially expressed clones. ACGCCGCCCGTTGACTACTCGTTTCTATCACGCGCTTCCTACCTCCTTCCTCTTTCTTCTTCTTCTTTTTTTTTTCTTTTTTTTCCTGAATGCTTCCTTAGAAATTTCACTGGAGAATCT 121 TCCCCCACTTAATAGTTGAATCGTATATATACGCGTTAGAGAAAGATTTTCTATCGCAAACAATCAAGCCATTCGTACACAGAGTCCTTAATTATTCCACCTCTCTTCCTTTAAATTTCC 241 TCTAATTACTCAGCTTGAGGCAGTTTATTGAGGCACGTCGGCAGGTCGCATCTCTTTCTGAAATACTAATCGTTTGATATAATATTTGACTTCATTCAATTAGGAGATATGGCGAGATCG 361 M A R S CACGTTCTTCCAATGATTGGGTTCCTGTTCATGGTTATTTTCCGAGTTTGCTCCGGTCAGATCGCTCCTTCTCCGACGGCGGAAGTCCCAGCGTCAAGCGACGGCACTGCAATTGACCAA 481 H V L P M I G F L F M V I F R V C S G Q I A P S P T A E V P A S S D G T A I D Q GGAATCGCTTACCTGTTGCTTCTGCTCGCTCTCGCCATCACTTACACCTTCCACTGGTAGCAATCTTTTTTCCTATCACTTCCTATTATATCGCTGAAACCGAATGCGGAATAGAAGAAG 601 G I A Y L L L L L A L A I T Y T F H W * AATATCTATCGATTGTAGAGAGATTTGAGGGTTCGAAATGATTTGTATCTCCCAGCCCAATTCTTTTTAGATTAGAAACCCCCATTTTTTTAATTAATAAATAAATATAAATGTACTGAG 721 ATTTATTTCATTTTTCTTACGAATCTACTGTTACCGTGTAATTTAAATAAGATAGGGCAATTCTTGTGTTTATAAACGACGTTGGTACTTCTCCCATAAAAAAAAAAAAAAAAAAAAAAA 841 AAAAAAA 848 Fig. 5. Full-length cDNA sequence of Clone A7. It codes a protein with 63 amino acids.