1 / 37

English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis

English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis Tuesday, 8:30 – 10:00 Ü Thursday 10:15-11:45 (s tart: O c t . 23) Next semester: Praktikum + Seminar Thereafter possibility for Masters thesis. Anwesenheitspflicht in VL und Ü (Liste!)

metta
Download Presentation

English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis Tuesday, 8:30 – 10:00 Ü Thursday 10:15-11:45 (start: Oct.23) Next semester: Praktikum + Seminar Thereafter possibility for Masters thesis. Anwesenheitspflicht in VL und Ü (Liste!) Literature: See course web page.

  2. 21. OktMicroarray-Technologien Martin Vingron • 28. OktGrundlagen der Datenanalyse Christine Steinhoff • 4. Nov Varianzanalyse I Christine Steinhoff • 11. NovVarianzanalyse IIChristine Steinhoff • 18. NovLOWESS, VarianzstabilisierungAnja von Heydebreck • 25. NovStatistisches TestenAnja von Heydebreck • 2. DezClusterverfahren Anja von Heydebreck • 9. DezKlassifikation, Lin. DiskriminanzanalyseRainer Spang • 16. DezAnwendungen in der KrebsforschungRainer Spang • 6. JanHauptkomponentenanalyse Martin Vingron • 13. JanStatistische Lerntheorie Rainer Spang • 20. JanSequenzannotationRainer Spang • 27. JanBayessche NetzwerkeRainer Spang • 14 3. FebRegulation Martin Vingron • 15 10. FebZusammenfassung, Wiederholung, Ausblick

  3. Genome Sequencing: Functional Genomics: Determination of DNA sequence Derivation of amino acid sequences Analysis, comparison, classification Study of gene function gene expression studies proteomics metabolic networks

  4. DNA gene transcription messenger RNA (mRNA) translation protein sequence structure

  5. A cell and its population of genes:

  6. What is the problem? Determine the amount of mRNA for each gene that is present in a cell/tissue.

  7. DNA forms double strands by a process called hybridization:

  8. Labeling

  9. Hybridization

  10. Expression Arrays cDNA Arrays Oligonucleotide Arrays Glas Arrays Membrane based Arrays

  11. Glass Slide Microarrays … were first produced at Stanford University (Schena et al, 1995). Whole cDNA: 500-1500 bp

  12. Filter “Macro”arrays … were first published by Lennon and Lehrach, 1991 7.5x2.5cm Ca 21 cm

  13. probe cell probe pair 1 2 3 4 ... 17 18 19 20 ... PM MM ... probe set Oligonucleotide Arrays … were first published by Lockhardt et al, 1996 ... TGTGATGGTGGGAATGGGTCAGAAGGACTCCTATGTGGGTGACGAGGCC TTACCCAGTCTTCCTGAGGATACAC TTACCCAGTCTTGCTGAGGATACAC ca 25bp

  14. C C C C C C C C A A A A A A A A C C C C C C C C G G G G G G G G Probe - Reference

  15. There are other technologies, too, to estimate expression levels: • EST sequencing – „electronic northern“ • SAGE: tags of mRNAs are concatenated and sequenced • Reliability of results depends on depth of probing (number of ESTs, number of tags)

  16. Why do we want to know? • „tissue profiling“: which genes are expressed in a tissue • Comparing healthy and diseased (e.g., tumor) tissue • Studying dynamic processes: E.g., cell cycle (time series)

  17. Example: Renal clear cell carcinoma Comparison of kidney cancer cells to normal tissue. Which genes are altered in their expression?

  18. N98-8880 T98-8880 Molecular Genome Analysis Dr. Judith Boer

  19. Example: Cell cycle time course G1 S G2 M Spellman et al took several samples per time-point and hybridized the RNA to a glass chips with all yeast genes

  20. Data processing • Image collection • Image analysis, intensity determination • Within slide normalization

  21. Trends in Biotech Hess et al, 19(11),2001

  22. ... Trends in Biotech Hess et al, 19(11),2001 ... OUPUT: Scanner + Scanner-Software

  23. Different technologies • Support: membrane or glass slide • Spotted material: PCR product or oligo (short/long) • Labeling: • 1-channel: radioactive, Affy • Absolute values • 2-channel: 2 color fluorescent labeling • Relative values

  24. Quality issues

  25. subpopulations: PCR Remedies: improve PCR protocols; model “random effect” through plate-wise calibration

  26. subpopulations: pin Remedies: handling of pins; pin-wise calibration

  27. Distribution of intensities: log-normal? intensities log intensities QQPlot Histogramm

  28. Chip design • Type of chip: • Global „whole genome“ (yeast, drosophila, mouse, man) • Domain specific, e.g. cancer, infection • Spots: • PCR products: E.g., 3´ UTR (avoid crosshyb.) • Oligos: uniqueness, stability

  29. Databases • Stanford • TIGR • Gene expression atlas • GEO • Arrayexpress • MIAME standard: Minimum Information About a Microarray Experiment

  30. Software • R + Bioconductor • Jexpress • Genesprings • Rosetta Resolver

  31. Affymetrix technology • Per gene, spot 20 perfectly matching oligos and 20 oligos with 1 mismatch • Intensity: weighted average of pixel intensities in perfect and mismatch oligos (More on this next week)

More Related