Novel Approach to Parkinson s Fusion Protein Therapy

1. Novel Approach to Parkinson�s Fusion Protein Therapy Jisu Ha Tameem Kurd-Misto ThuVan Tran Rahul Oliver

2. Objective Propose a Molecular technique that mimic Deep Brain Simulation to treat Parkinson�s Disease

3. Overview Parkinson�s Disease Current Alternatives/Treatments Dopamine Pathways Our Proposal Mechanism Medical Device Project Timeline Challenges

4. Parkinson�s Disease Neurological Movement Disorder 500,000 people affected US 4 million world wide 50,000 new cases annually NO CURE

5. Treatment Options Drug therapies (i.e. L-DOPA) Surgical Procedures (Pallidotomy) Deep Brain Stimulation (DBS) Transplant Healthy Dopamine And More�

6. Potential Solution Utilize Fusion Protein Adenylyl Cyclase Type 1 Channelrhodopsin-2 Halorhodopsin Implantable Controller LED Lights Impulse Control Wireless

7. Motor-Loop Pathway

8. Parkinson�s Motor Loop

9. Fusion Protein Therapy (F.P.T) Modify critical enzyme in cAMP dependent pathway to carry out signal transduction in the cell.

10. Molecular & Cellular Level In people without Parkinson�s, when DA (ligands) binds to D1 or D2 receptor (G-coupled protein receptors) it leads to the dissociation of the G-protein (molecular switches). For example in D1, G-protein dissociated into G(alpha) and G(beta/gamma) units. G(alpha) binds to AC and stimulates the enzyme to initiate second messenger pathways. In D2, upon DA binding leads to dissociation of the G-protein as well, however, the there is another class of G (alpha/s) subunit which when bound to AC inhibits it�s activity. Now in Parkinson�s because there is not DA these second messenger cannot be fully activated hence results in turncation of signal transduction. Therefore we propose a fusion protein that could potentially be controlled by light hence the signal transduction could be modulated with DA. In people without Parkinson�s, when DA (ligands) binds to D1 or D2 receptor (G-coupled protein receptors) it leads to the dissociation of the G-protein (molecular switches). For example in D1, G-protein dissociated into G(alpha) and G(beta/gamma) units. G(alpha) binds to AC and stimulates the enzyme to initiate second messenger pathways. In D2, upon DA binding leads to dissociation of the G-protein as well, however, the there is another class of G (alpha/s) subunit which when bound to AC inhibits it�s activity. Now in Parkinson�s because there is not DA these second messenger cannot be fully activated hence results in turncation of signal transduction. Therefore we propose a fusion protein that could potentially be controlled by light hence the signal transduction could be modulated with DA.

11. Fusion Protein hChr2 and h2 can be precisely controlled by different wavelength of lights. Blue light triggers a conformational change in the hChR2 to open and facilitates the movement of Ca2+ into the cell. The opening of the hChR2 raises the membrane potential and allows for signal transduction. Yellow light triggers the opening of h2 and allows the influx of Cl- through the channel into the cell. This will allow the membrane potential to recover from earlier activation Main premise: Because the AC is coupled a conformational change in light sensitive proteins will induce a conformational change in AC causing activation/deactivation of the enzyme without the presence of G subunit. (Based on current research)hChr2 and h2 can be precisely controlled by different wavelength of lights. Blue light triggers a conformational change in the hChR2 to open and facilitates the movement of Ca2+ into the cell. The opening of the hChR2 raises the membrane potential and allows for signal transduction. Yellow light triggers the opening of h2 and allows the influx of Cl- through the channel into the cell. This will allow the membrane potential to recover from earlier activation Main premise: Because the AC is coupled a conformational change in light sensitive proteins will induce a conformational change in AC causing activation/deactivation of the enzyme without the presence of G subunit. (Based on current research)

12. Components of Fusion Protein Adenylyl Cylclase type 1 Transmembrane proteins 9 different Isoforms Stimulated by (type 1, 3, 8) G-protein Ca2+/calmodulin (calcium modulated proteins) Activate cAMP dependent pathway Signal transduction pathways Second messenger cascade system Adenylate Cyclase is a transmembrane protein that catalyzes ATP to form cAMP. Adenylate Cyclase is a transmembrane protein that catalyzes ATP to form cAMP.

13. Components (Continued) Channelrhodopsin-2 Light-activated cation channel 7 TM domains conformational change with blue light Halorhodopsin-2 Light-activated chloride pump 7 TM domains conformational change with yellow light Here are the components of our fusion protien. Both proteins belong to the opsin family and can be stimulated by light. Here are the components of our fusion protien. Both proteins belong to the opsin family and can be stimulated by light.

14. Approach to Solution Determine best combination hChr2 � AC1 � h2 hChr2-h2-AC1 AC1-hChr2-h2 Other combinations � 32 Highest Expression Rate

15. Construct a Vector Ad5 Vectors Can infect broad range of Mammalian cells Demonstrated expression of recombinant proteins in most mammalian cell Can infect both replicative and non-replicate cells High replication efficiency

16. Proposed Vector Construct

17. Promoter Region Endogenous Promoter for AC 1 Approximately 3 Kbp upstream from first Exon Utilized Promoter Prediction Software 2.0 3 queries suggested Highest Score for likely Promoter Region gacttcagcatataaatggtgggcagaggggaccacaattcaacttttga One main reason is that AC activation, normally, requires multiple signals and transcription factors working together to be activated. One main reason is that AC activation, normally, requires multiple signals and transcription factors working together to be activated.

18. Restriction Enzymes Low compatibility for exact splicing (Eco571) Utilize Commercial Adapters Biogen Invitrogen Upon analysis, we were only able to find one useful restriction site, therefore we want to utilize adapters to increase specificity and expression of the vector. Upon analysis, we were only able to find one useful restriction site, therefore we want to utilize adapters to increase specificity and expression of the vector.

19. Other Options Buy Vector Kit Invitrogen � ViraPower Adenoviral Expression System Approximately $900.00 Utilize Patent Vector Require Licensing upon successful proof of concept

20. Target Cells Medium Spiny Neurons in the Putamen Putamen Cell Culture Animal Model Clinical Testing Microinjection At Specified intervals

21. Expression Analysis Utilize Available cAMP activity Kits � BioRad Utilize PCR for detection

22. Motivation Channelrhodopsin and Halorhodopsin Light activated ion channel Another application of eye sight for the blindness 10ms 40Hz Deep Brain Stimulation Stimulation from outside

23. Design Definition Quality of patient�s life Low power consumption Long life span Reliability Convenience to use Wireless/wearable design

24. Micro LEDs Light Emitting Diode Low power consumption Long life span Stable light supply Independent source

26. Wireless power transmission Faraday�s law

27. Wearable design

28. Projected Timeline(2009 � 2016)

29. GOAL DURING FIRST YEAR

30. Money Requirements

31. Challenges

32. Why Successful A patent EP1222287 (US7205135) which propose potential use of adenylate cyclase to treat disease EP1222287 Isolated nucleotide sequences for adenylate cyclase Recombinant DNA submitted to ATCC American Type Culture Collection (bank for culture collections) PTA-1661 Vectors shown to have created and inserted with high expression vectors into mammalian cells Current research has shown the enhancement of AC using light Our Proposal: Bypassing the dopamine D1 and D2 Modulate cAMP will provide fine tuning of motor activities

33. Special Thanks Dr. Dave Dyer Dr. Math Cuajanco Albert Chow Benham Radi

34. Reference http://www.freerepublic.com/focus/f-chat/2330603/posts http://blog.pcnews.ro/2008/02/08/deep-brain-stimulation-for-depression/ www.google.com The neurophotonic interface:stimulating neurons with light, Nir Grossman et al, The Neuromorphic Engineer, 2008 Channelrhodopsin,G.Nagel et al, Nature Neuroscience, 2005 Boyden, E. S. et al. Millisecond-timescale, genetically targeted optical control of neural activity. Nature Neuroscience. 8: 1263-1268 (2005). Han, X. and Boyden, E. Multiple-color optical activation, silencing, and desynchronization of neural activity, with single-spike temporal resolution. Plos ONE. 3: e299 1-12 (2007). Nagel, G. et al. Channelrhodopsin-2, a directly light-gated cation-selective membrane channel. Proc. Natl. Acad. Sci. 100: 13940-13945 (2003). Nagel, G. et al. Channelrhodopsins: directly light-gated cation channels. Bio. Soc. 33: 863-866 (2005). http://www.neurosurgery.pitt.edu/imageguided/movement/stimulation.html http://health.nytimes.com/health/guides/disease/parkinsons-disease/levadopa-(l-dopa).html

35. References (continued) http://www.everyvector.com/sequences/show_public/2491 http://www.freepatentsonline.com/7205135.pdf http://biomed.brown.edu/Courses/BI108/BI108_2003_Groups/Deep_Brain_Stimulation/motorloop.html http://findarticles.com/p/articles/mi_m2459/is_n4_v23/ai_15657872/ http://www.vivo.colostate.edu/hbooks/molecules/cyclase.html http://www.emunix.emich.edu/~rwinning/genetics/tech.htm http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html UniProt Database (www.uniprot.org) Expasy Database (www.expasy.org) Promotor Prediction Software 2.0 http://www.genescript.com Protein Database (www.pdb.org)

36. Any Questions? Thank You!