1 / 18

Routine Molecular Epidemiology for Enhanced Detection and Control of Foodborne Outbreaks

Learn about molecular epidemiology methods for detecting and managing foodborne outbreaks effectively. Explore genotypic and phenotypic techniques, including DNA analysis and protein profiling. Understand the importance of interpreting data accurately.

millette
Download Presentation

Routine Molecular Epidemiology for Enhanced Detection and Control of Foodborne Outbreaks

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Routine Molecular Epidemiology for Enhanced Detection and Control of Foodborne Outbreaks Lee H. Harrison, MD Associate Professor Departments of Epidemiology and Medicine University of Pittsburgh

  2. What is molecular epidemiology in infectious diseases? • Purpose: Determine modes of transmission and source of infection • Principal: Exploit pheno-/genotypic differences between strains • Practice: Molecular subtyping of bacterial/fungal/viral/parasitic isolates

  3. Molecular Epidemiology in Infectious Diseases: Why molecular methods? • Previously used methods: • antimicrobial susceptibility patterns • serologic/biochemical typing • Examples: • 95% of invasive H. influenzae were serotype b • L. monocytogenes: 3 major serotypes (1/2a, 1/2b, 4b)

  4. Molecular Epidemiology in Infectious Diseases: Basic Types of Methods • Genotypic methods • DNA based • Heritable and stable • Not affected by isolation/culture conditions • Phenotypic methods • Rely on expressed characteristics • Affected by isolation/culture/test conditions

  5. Molecular Epidemiology in Infectious Diseases: Common Methods • Analysis of chromosomal DNA • Restriction endonuclease analysis (REA) • Pulse field gel electrophoresis (PFGE) • Restriction fragment length polymorphism (RFLP) • rDNA gene restriction patterns (ribotyping) • Nucleic acid sequencing • Nucleic acid hybridization of entire genome

  6. Molecular Epidemiology in Infectious Diseases: Common Methods • Analysis of plasmid DNA • Plasmid size • Restriction digests • Protein analysis • Outer membrane protein (OMP) analysis • Multilocus enzyme typing (MLE)

  7. Click for larger picture

  8. Endonuclease EcoR I Hind III Hha II Sequence GAATTC CTTAAG AAGCTT TTCGAA CCGG GGCC Recognition Sequences ofSelected Restriction Endonucleases Source Escherichia coli RY13 H. influenzae Rd H. parainfluenze

  9. DNA Cutting by HIND III: StaggeredCuts Leaving “Sticky” Ends TTCGAATAAGCTTCCCTGAG AAGCTTATTCGAAGGGACTC TTCGAATA AAGCTTATTCG AGCTTCCCTGAG AAGGGACTC +

  10. General principals of molecular subtyping using restriction endonucleases Bacterial chromosomal DNA . C . C . C . C Electrophoresis . C . . C . . C C C . C = Restriction endonuclease (“molecular scissors”) = DNA sequence recognized by restriction endonuclease

  11. Molecular Epidemiology in Infectious Diseases: Common Methods • Nucleic acid detection • Plasmid size • Restriction digests • Phage typing

  12. Pulsed-Field Gel Electrophoresis

  13. Genetic relatedness (dendrogram) analysis

  14. Molecular Epidemiology in Infectious Diseases: Interpretation of Data • Heterogeneity within species • Must have knowledge of frequency distribution of subtypes • Utility of individual method is species specific

  15. Molecular Epidemiology in Infectious Diseases: Requirements • Method must work with vast majority of isolates • Reproducibility • Discrimination power • Ease of method • Ease of interpretation

More Related