1 / 26

LSM2104 Project Guidelines

LSM2104 Project Guidelines. 18 th February 2003. Outline. Setp 0: How to use MS-FrontPage to create web page(s) Go through Step 1 of the project Using known gene to BLAST against pseudomallei genome itself Report the location of CDS Go through Step 2 of the project

minerva-little
Download Presentation

LSM2104 Project Guidelines

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. LSM2104 Project Guidelines 18th February 2003

  2. Outline • Setp 0: How to use MS-FrontPage to create web page(s) • Go through Step 1 of the project • Using known gene to BLAST against pseudomallei genome itself • Report the location of CDS • Go through Step 2 of the project • Using unknown gene from related organisms to BLAST against pseudomallei genome • Find and report the location of CDS • Using CLUSTALW to do MSA

  3. Step 0 : Using MS-Front Page • Inserting email address • Inserting images & background • Inserting hyperlinks • Bookmark(s) within the page • Link(s) to other web pages • NOTE : uploading to the web server will be taught in later session

  4. Step 1 : Find and locate a known B.pseudomallei gene on the genome • Goto Genbank/Swiss-Prot: http://www3.ncbi.nlm.nih.gov/ • Type in keyword: pseudomallei flagellin complete cds • Look at the entry : AF030239 • Extract the protein sequence (in FASTA format) to do Blast

  5. Blast Overview • Blastp: • An amino acid query sequence against protein sequence database • Blastn: • A nucleotide query sequence against nucleotide sequence database • Blastx: • A nucleotide query sequence translated in all reading frames against protein sequence database • Tblastn: • A protein query sequence against a nucleotide sequence database dynamically translated in all reading frames • Tblastx: • Compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.

  6. How to BLAST • Perform tBLASTn at http://sf01.bic.nus.edu.sg/blast/blast.html • Output explanation (http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/glossary2.html) • Score • Expectation value • Identities • Positives • Frame • Report the location of CDS

  7. Your Assigned Gene for Step 1 Must include at least this gene Q9RGS8 : Non-hemolytic phospholipase C, found from Swiss-Prot

  8. Step 2: Find and locate unknown genes in Burkholderia pseudomallei • Minimum: must include at least the assigned 2 genes from Burkholderia genus (but unknown to B. pseudomallei) • Extract the protein sequences out to tBLASTn against B. pseudomallei genome. • Find and report the locations of the CDS • Use ClustalW to reconfirm your findings.

  9. Reporting location of CDS BLAST results B.P genome Complete CDS Matched fragment Query sequence

  10. Pick a known gene from related organism in same genus For example • N-acyl homoserine lactone synthase (AAK70351) • from Burkholderia stabilis

  11. Procedure

  12. http://sf01.bic.nus.edu.sg/extract/ • Extension of ends • Direction

  13. BpsChrom2 Burkholderia pseudomallei chromosome 2 (1177310-1178131 ) atcgcgccgcgcgcgcgaaacacgagcccctgtctgccgagccgcacgagcggcaggcgt tcggcgaacgacgggaacgcgacggcgatgcgggtttcgccggcatcgaacgtagggagc atcgcgcgaaataccgttgaatggtccacggtgtagaggtctccttgaatgacgaacggc gcggccccgaagcggggcgaccgggcgcgctcaggcggcttcggcgggcggcgcgcacag cagcgggtcgagatcgagcgcggcgagcgtttgcgcgtcgaggtcgatccagcacgcgac gaccatgcgcccgtcgatctgctgcgcgggccccgcccggtgcgcgtgcacgccgatccg gcggaacaggcgctccatgctcagaaacgtcacgccgatcagttgcttcgcgccaagccg cgcggcgcactcgacgacggcggcgagcatcggccgcaccgcccaggccgggttgccgcc cccggccggatcctcggcgttcgcggcgaagcgcgacaattcccagacggcggcggattg cggcaacggcatgtcttgcgcgaccagcgtcgggaacagttccttcagcagatacgggcg ggtcgtcggcagcagccgggcgcagccgcagatttccccgtcgtcgtcgcgggcgaacac atagacggtatcgtcgcgatcgtactgatcccgctcgaacccttcgcttgccgacggcag tttccagccgagctgctcgacgaaaactcggtgccgataaaggcccagatcagccgccaa gtcgctcggcaggcgcccgtcgccatgaacgaaagttcgcat

  14. http://sf01.bic.nus.edu.sg/translate/

  15. Report the location of CDs

  16. ClustalW (http://clustalw.genome.ad.jp)

  17. How to use ClustalW • Input sequences: • 4 Flagellin genes from different organisms, save them into one file in fasta format from GenBank: • AJ496283. Legionella longbe...[gi:22553065] • AJ496282. Fluoribacter boze...[gi:22553063] • AF030239. Burkholderia pseu...[gi:3337408] • AF307102. Borrelia parkeri ...[gi:11095317] • Copy and paste into the window

  18. Symbol Found In the Results: '*' indicates positions which have a single, fully conserved residue • ':' indicates that one of the following 'strong' groups is fully conserved:-STA NEQK NHQK NDEQ QHRK MILV MILF HY FYW • '.' indicates that one of the following 'weaker' groups is fully conserved:-CSA ATV SAG STNK STPA SGND SNDEQK NDEQHK NEQHRK FVLIM HFY

  19. Dendrogram

  20. Your minimum genes for step 2 Include at least these 2 genes from GenBank from Burkholderia genus: • AF525414 • AF333004

  21. End

  22. Step 1 (cont.) • Goto http://sf01.bic.nus.edu.sg/extract/e2.html • Type in the start & end base number (e.g. extend by 150 nucleotides) • Start position : (2902870 – 150) • End position : (2904966 + 150) • Explain why & when need to +/-

  23. Step 1 • Extract out the nucleotide sequence from the output • Do a translation, paste in the sequence at http://sf01.bic.nus.edu.sg/translate/ • Extract the amino acid residues sequence • Do a BLAST again on the extracted sequence at http://sf01.bic.nus.edu.sg/blast/blast.html

More Related