1 / 31

Promoting fungi in the DNA barcoding movement

Promoting fungi in the DNA barcoding movement. Keith A. Seifert 1 , Ursula Eberhardt 2 , Conrad L. Schoch 3 1 Biodiversity, Agriculture & Agri-Food Canada, Ottawa, Ontario 2 CBS Fungal Diversity Centre, Utrecht, the Netherlands

nailah
Download Presentation

Promoting fungi in the DNA barcoding movement

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Promoting fungi in the DNA barcoding movement Keith A. Seifert1 , Ursula Eberhardt2 , Conrad L. Schoch3 1Biodiversity, Agriculture & Agri-Food Canada, Ottawa, Ontario 2 CBS Fungal Diversity Centre, Utrecht, the Netherlands 3 National Centre for Biotechnology Information, Bethesda, MD (GenBank)

  2. MSA symposium 2010 Politics! 1:00 Advances in DNA barcoding for fungi. Conrad L. Schoch, Keith A. Seifert Specific Genes 1:30 DNA barcoding using cytochrome c oxidase I (COI): A valuable addition to oomycete molecular taxonomy.Gregg Robideau et al. 2:00 Barcoding the Yeasts – Which Genes? Cletus P. Kurtzman 2:30 Coffee Break Applications 3:00 Barcoding the Dothideomycetes and Sordariomycetes. Andy N. Miller 3:30 Barcoding agaric fungi in the Great Smoky Mountains National Park: What have we learned?   Karen W. Hughes et al. 4:00 Challenges and successes in ITS barcoding of fungal communities in Alaskan boreal forest soil.  L. Taylor 4:30 Discussion Aftermath A chat over beer

  3. IMC Symposium U5 – Fungal Barcoding Chairs: Ursula Eberhardt & Keith Seifert Promoting fungi in the DNA barcoding movement KA Seifert*, U Eberhardt, CL Schoch Practice towards DNA barcoding of the nectriaceous fungi P. Zhao, J. Luo, W.-Y. Zhuang* DNA Barcoding of the mycobiota in indoor environments R A Samson* The ITS region as barcoding for medical fungi W Meyer*, C Serena, S Chen, M Arabatzis, A Velegraki DNA barcoding of arbuscular mycorrhizal fungi (Glomeromycota) A. Schuessler*, H. Stockinger, M. Krueger DNA barcoding of fungal endophytes from a Eucalyptus grandis tree in South Africa K Pillay, M Gryzenhout*, B Slippers, MJ Wingfield QBOL - Barcoding organisms of quarantine importance to Europe J.Z. Groenewald*, W. Quaedvlieg, P.J.M. Bonants, N. Boonham, P.W. Crous

  4. Overview • The politics of DNA barcoding. • What happened to cox1? • Should ITS be the official Fungal Barcode? • Data standards for the barcode keyword. • Data resources for DNA barcoding. • International barcoding projects Our goal: Motivate mycological participation in DNA barcoding! • Formalize the fungal barcode. • Establish Fungal Working Group • Develop new fungal barcoding projects. • Participate in multi-kingdom projects. “DNA, you know, is Midas’ gold. Everybody who touches it goes mad.” Maurice Wilkins, quoted in The Eighth Day of Creation

  5. What is DNA barcoding? Pre-2002 (or whenever) Trichocladium asperum Humicola grisea Pileus comex to comparmulate, lemellae ascending-adnote, peleipellis of clonate cells, chilocystidia ventruiore to eubryludinal, basidiospores with pronviant apical gum pore .……………………………………………………………………………………….Panaeolus mallochii Pileus glalions to finely primrose, lemellae dark blocked umpher, peleipellis hymenform, cheilocystidia a continuous timule margin, bandospins conspeniously compressed ………………………………………………………………………………….. Panaeolus summerbellii Post-2002 (or whenever) CATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAATAAACTGGGTGGGTTGTTGCTGTCCCTCTCGGGGGAACTGTGCACGCCTTACCTTTTTTGTTTTTCCACCTGTGAA ………………………………………………………Panaeolus mallochii CATTATTGAATAAACTTGGTTAGGTTGCTGCTGGCTCCTTGGAGCATGTGCACACCTAGCACCNTTTTTACCACCTGTGCACCCTTTGTAGACCTGGATACCTCTCGAGGAAACTCGGTTTGAGGAC ………………………………………………………………………………. Panaeolus summerbellii …………………………………..……………………………………………………Panaeolus mallochii ….………………………………………………………………………………. Panaeolus summerbellii OR

  6. Consortium for the Barcode of Life (CBOL) • Regulates the ‘barcode’ keyword for GenBank • Organization • Secretariat • Smithsonian Institution, Washington, D.C., USA • 5 people • Executive Committee • 7 members, including Pedro Crous • Implementation Board • 19 members, including Conrad Schoch • Members • 200 Member Organizations, 50 countries • Natural history museums, biodiversity organizations • Users: e.g., government agencies • Private sector biotech companies, database providers • Facilitates barcoding but does not fund research www.barcodeoflife.org

  7. The Barcode Keyword in GenBankThe Barcode Data Standard • Sequence records with… • Voucher specimens • On-line metadata • Reliable standard of taxonomic identification • Agreed gene region • sanctioned by peer review by CBOL Implementation Board • Sequence traces • Identification of unknowns of ALL kingdoms (except bacteria) • GenBank • Barcode of Life Database (BOLD)

  8. Barcode What is DNA Barcoding? Part 2. • All Kingdoms, All Species, One gene (or two or three genes?) • The purpose is identification … NOT phylogeny • In animals, the barcode gene is cytochrome oxidase 1 (cox1 or CO1) • A single copy mitochondrial gene, AT rich • 648 bp region is the core for animals • In plants, the barcode genes are matKand rbcL • Hollingsworth et al., 2009, PNAS 106: 12794–12797, 2009. • In fungi, the barcode gene has not been formalized • By default it is cox1 until an alternative is accepted

  9. What is DNA Barcoding? Part 3. • Big science • More than $100,000,000 • Biodiversity Institute of Ontario (Guelph) • Netherlands Centre for Biodiversity Naturalis (Leiden) – € 30 million • High throughput sequencing • Near genome centre volumes • Immediate data release policy (based on public genome model) is controversial • Primer mixes often used for PCR • M13 tagged sequencing primers • Data release papers

  10. What is DNA Barcoding? Part 4. • Taxon specific ‘campaigns’ • Development of multikingdom databases • For use by all scientists and the public… not just mycologists • Multi-kingdom projects • QBOL – Quarantine Barcode of Life • Ecological projects • IM-Bol Indoor Mycota Barcode of Life • Geographic Projects • Moorea www.lepbarcoding.org www.barcodingbirds.org www.fishbol.org mooreabiocode.org

  11. Barcode of Life Database – BOLDwww.boldsystems.orgMirrored in China, negotiations with ECBol, Australia, Mexico • Accepts ITS sequences as barcodes • Submission open to anyone • Few fungal sequences • Spreadsheets for metadata • No specific fungal format • Process can be tedious • Images of specimens • Descriptions • ‘Automated’ GenBank submission

  12. Barcode Submission Tool www.ncbi.nlm.nih.gov/WebSub/index.cgi?tool=barcode • Familiar submission process • Trace archive available • www.ncbi.nlm.nih.gov/Traces/home/ • ITS sequences not yet accepted as barcodes • Submission open to anyone • Few fungal barcode sequences are now cox1 • Metadata must be stored off-site

  13. RefSeq Targeted Loci www.ncbi.nlm.nih.gov/RefSeq/ • Bacteria: all type sequences • Fungi: 200 sequences from AFToL, 28S, 18S, just beginning INSD (International Nucleotide Sequence Databases) DDBJ EMBL GenBank model organisms reference organisms genomic level selection & some curation (NCBI) submission RefSeq 16S rRNA* other molecular markers other RNAs

  14. RefSeq Accession # Project number Additional references RefSeq references Expanded qualifiers

  15. Criticisms of DNA Barcoding • Not science (or bad science) • A threat to classical taxonomy • Removes funding from classical taxonomy • Standardization of markers impossible • Oversimplifies delimiting species • It is not phylogeny • Distrust and questioning of CBOL’s mandate • National pride • Disciplinary pride

  16. www.ibolproject.org

  17. iBOL Member Nations Each central node should have a high-throughput DNA barcoding facility Now Canada US France Poland Scientific Steering Committee (mycologists): Pedro Crous, Keith Seifert

  18. ECBOL- European Consortium for the Barcode of Life Mission: To unleash the potential of European expertise and collections to contribute towards identifying life on earth. • Plan: • Establish a Network of European Leading Laboratories (NELL) • Formalise National DNA barcoding campaigns in each European country • Establish new projects and barcoding campaigns, • Functioning as the European node for international initiatives such as iBOL Participating countries: Belgium, Finland, France, Germany, Italy, Lithuania, Netherlands, Norway, Poland, Portugal, Spain, Switzerland, U.K. www.ecbol.org ECBOL2 meeting June 2010, Braga, Portugal Lorenzo Lombard l.lombard@cbs.knaw.nl

  19. Selecting barcode genes • International Nucleotide Sequence Database Collaboration • INSDC, GenBank, the European Molecular Biology Laboratory and the DNA Data Bank of Japan • CBOL Implementation Board decides by peer review which gene regions receive BARCODE status • Possible reasons for rejection of cox1 • PCR problems (amplification or primer problems) • Patterns of inter- and infraspecific variation • Resolving power • Selection of new genes • Patterns of inter- and infraspecific variation • Prefer a ‘barcode’ gap • Universality of primer pair etc.

  20. Comparison of barcodes in Oomycetes (250 species) ITS cox1 LSU n=1179 n= 1179 n=375 Min 0 Mean 0.297 Max 0.539 Min 0 Mean 0.102 Max 0.307 Min 0 Mean 0.098 Max 0.201 Percent of strains within species between species Min 0 Mean 0.004 Max 0.062 Min 0 Mean 0.004 Max 0.037 Min 0 Mean 0.002 Max 0.037 Average pairwise distance Courtesy Gregg Robideau & André Lévesque

  21. cox1 Barcoding of Eumycota & Oomycota 0 introns F. oxysporum genome 1 1 intron F. circinatum DAOM235753 F. sacchari DAOM 235795 2 introns 3 spp./3 major clades. Identical barcodes. F. verticillioides genome ** 3 introns F. circinatum DAOM 235752 b1 7 introns F. circinatum DAOM 235752 b5 F. graminearum DAOM 235624 F. graminearum DAOM 235800 F. oxysporum genome 2 Species resolution in Penicillium cox1 67.1 % B-tub 81.2 % ITS 24.5 % Fusarium. Low resolution. Multiple copies.

  22. All Fungi Barcode of Life Planning Workshop Smithsonian Conservation and Research Center Front Royal, Virginia 13-15 May 2007 Zasmidium nocoxi Crous Rossman, AY. 2007. Report of the Planning Workshop for All Fungi DNA Barcoding. Inoculum 58(6): 1-5.

  23. The ITS reality… Hurray! • Large reference database • most not barcode data standard compliant • Robust primers • Strong demand from many mycologists that this be the fungal barcode • Especially ecologists studying environmental metagenomics

  24. The ITS Reality – BOO! • Multiple copies within species • At this conference… • Dan Lindner – Laetiporus, this conference • Uwe Simon & M. Weiss – Ascomycetes • Of concern for cloning based and metagenomic studies wanting to use barcode ID databases • Serious lack of resolution in Ascomycetes • Possibly too short • 500-700 bp optimum barcode but subtract 150 bp 5.8S… • Chimera problems for some methodological approaches

  25. The Ascomycete Barcode Problem Dikarya • ITS (and cox1) lack resolution in many groups • A second barcode is needed • TEF1-α • RPB1 or RPB2 • Mcm7 Schmitt et al. 2009. Persoonia 23: 35-40. • FG1565 • MS204 • FG1093 • V. Robert @ CBS/ C. Lewis @ AAFC • Ascomycete Barcode Working Subgroup? Fungi RPB1 RPB2 TEF • dowalker@eden.rutgers.edu RPB1 per net RPB2 Courtesy J. Spatafora TEF

  26. Action • Establish Fungal DNA Barcoding Working Group • Chair: Conrad Schoch • International Membership • 10-15 members • Establish Ascomycete subgroup (or other subgroups?) • Establish Working Plan • Prepare Fungal Barcoding proposal • For peer reviewed publication • For CBOL implementation board approval • CBOL will support meetings of WG as necessary

  27. Possible approaches • Volunteers needed for Fungal Working Group • Collaborators to provide data • Mine data from existing publications • Collaborators to provide DNA • Multiple strains per species • Multiple species per genus • Authorship open to all who contribute • AFTOL model • Sequencing of other markers • part of main proposal • or as separate activity • CBOL agreement with Life Tech • CONTACT: • Conrad Schoch: schoch2@ncbi.nlm.nih.gov

  28. Fungal DNA Barcoding – Proposed Proposal • General Barcode for Fungi • rDNA internal transcribed spacer (ITS) • Secondary barcodes • Yeasts • rDNA large subunit (28S, LSU) D2 region • Ascomycetes • Second barcode required, subsequent proposal • Oomycetes • A separate proposal • Data on ITS, cox1 and LSU now being prepared for publication • 2 barcode system • rDNA internal transcribed space (ITS) • rDNA large subunit (28S, LSU) D2 region • Other groups?

  29. CBOL Implementation BoardPeer review of barcode marker proposals Chairs • Robert Hanner, University of Guelph, Databases • Peter Hollingsworth, Royal Botanic Gardens Edinburgh, Plant WG • Line Le Gall, Muséum National d’Histoire Naturelle, Paris; Protist WG • Neil Sarkar, Marine Biol. Lab., Woods Hole, MA; Data analysis WG • Conrad Schoch, NCBI, GenBank Taxonomy, Fungal WG • Lee Weigt, Smithsonian Inst., Washington, DC; Leading Lab Network CBOL Campaign and Project Leaders • George Amato, American Museum of Natural History, Conservation • Damon Little, NY Botanical Garden, TreeBOL • Marc De Meyer, Royal Mus. Central Africa, Belgium; Tephritid Barcoding Initiative • Yvonne Linton, NHM, London; Mosquito Barcoding Initiative • Dirk Steinke, University of Guelph, MarBOL • Mark Stoeckle, Rockefeller University, ABBI • Pablo Luis Tubaro, Museum of Natural Sciences, Argentina, ABBI Liaisons for Associated Initiatives • Paul De Barro, CSIRO Agriculture Australia, invasive species • Scott Federhen, NCBI, GenBank Taxonomy • Paul Hebert, University of Guelph, iBOL • Daniel Masiga, ICIPE, Nairobi, Kenya, East Africa • Chris Meyer, Smithsonian Institution, Washington, Moorea/BioCode • Sujeevan Ratnasingham, Biodiversity Institute of Ontario, BOLD

  30. Websites www.barcodeoflife.org www.ecbol.org Thanks for images: Pedro Crous André Lévesque & Gregg Robideau Joey Spatafora www.lepbarcoding.org • Keith Seifert: keith.seifert@agr.gc.ca • Ursula Eberhardt: ursula.eberhardt@cbs.knaw.nl • Conrad Schoch: schoch2@ncbi.nlm.nih.gov www.qbol.org www.barcodingbirds.org www.fishbol.org www.ibolproject.org www.boldsystems.org

More Related