1 / 36

The first PCR cycle: The sequence between the two primers will be amplified

PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers is amplified. The first PCR cycle: The sequence between the two primers will be amplified. Four cycles of PCR.

nam
Download Presentation

The first PCR cycle: The sequence between the two primers will be amplified

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. PCR is another in vitro DNA synthesis reactionThe twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers is amplified

  2. The first PCR cycle:The sequence between the two primers will be amplified

  3. Four cycles of PCR

  4. Copy number of the sequence between the primers increases exponentially

  5. SEQUENCIAMENTO DE DNA ORF Profa. Dra. Maria Aparecida Fernandez Depto de Biologia Celular e Genética Universidade Estadual de Maringá

  6. Structure of dideoxynucleotide triphosphates

  7. Dideoxy DNA sequencing is an in vitro DNA synthesis reaction with a twist DNAP requires a template and a primer The primer is labeled so the DNA fragments synthesized can be detected by autoradiography. The [ddNTP] determines the distribution of chain lengths produced.

  8. Filme de raio X Auto-radiograma Leitura manual Alto peso molecular TGGCTCGGCCTCAAGTCGAGGTTATCAGATCTGCAACTCAA Baixo peso molecular

  9. Automated DNA Sequencing

  10. Reação de seqüênciamento

  11. Fragmentos amplificados na reação de seqüênciamento

  12. Typical output of an automated sequencer

  13. Eletroforese no seqüênciamento

  14. Captura do fluorescente e processamento da informação

  15. Seqüenciador automático

  16. Conjunto de 16 capilares

  17. Panorama no momento da corrida

  18. Análise preliminar pós corrida

  19. ELETROFEROGRAMAS

More Related