1 / 9

Asymmetry in Binding and Cleavage Specificities Found for Homing Endonuclease I- Ani I

Asymmetry in Binding and Cleavage Specificities Found for Homing Endonuclease I- Ani I. k cat. K M. Asymmetry in k cat and K M. Specificity Shifts for Designed Enzymes Modulating k cat or K M. -8G:C. +8C:G. Current Projects. Design and selection toward target site

nikita
Download Presentation

Asymmetry in Binding and Cleavage Specificities Found for Homing Endonuclease I- Ani I

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Asymmetry in Binding and Cleavage Specificities Found for Homing Endonuclease I-AniI kcat KM

  2. Asymmetry in kcat and KM

  3. Specificity Shifts for Designed Enzymes Modulating kcat or KM -8G:C +8C:G

  4. Current Projects • Design and selection toward target site • Built-in negative Selection System • Homologues and their target sites • Second shell effects (learning from homologues) WT site:TGAGGAGGTTTCTCTGTAAA FANCA_32:TTAGCAGCTCCCTCTGTCTC

  5. ArshiyaQuadri Benchmarking Selection System M5 (with and without I55V) survives with a single-target site, so used in all selections

  6. Built-in negative selection bla p15A origin pENDO-HE HE ORF Unwanted HE target sites araC pBAD promoter (arabinose inducible)

  7. ArshiyaQuadri Results of Negative Selection Benchmark: Recovery of -8G and +8C highly specific designs in this selection -> putting design directly in (works) and using a randomized library to try and recover them (going to sequencing). Using this selection in combination with other selection for -9T and for improving single-base pair designs.

  8. Second shell effects and homologues • Current endonuclease design is generally limited to target DNAs close to the sequence observed in crystal structures • Redesign of the overall curvature of LAGLIDADG endonucleases to expand the range of targets to DNA sequences assuming different conformations • Influence of second shell effects (core especially) • Vdi and Mso - Fabio • Onu and Ani and other uncharacterized homologues - Summer • Computational: analyzing homologues sequences and incorporating information into designs (Justin and Fabio) • Experimental: transplanting residues and selection (Summer and Fabio) • Identifying homologue target sites is not trivial • New method: using the selection system to identify the target sites

  9. Flexible-backbone design and second-shell mutations (justin) i.e. how to make Rosetta stabilize new backbones in a realistic and conservative fashion designed I-MsoI, -11 THY, -10 THY wildtype I-MsoI, wildtype -11 CYT, -10 ADE superposition “ccd” backbone design w/ 2nd shell mutations, with BLOSUM62 constraints because Rosetta over-mutates multistate design of DNA contacts only, for specificity The protocol that generated this result was: iterative

More Related